ID 2SSEEDPROT XX AC S000143 XX DT 5-Oct-1997 (created) kehi; XX DE Conserved in many storage-protein gene promoters; May be DE important for high activity of the napA promoter; XX KW storage protein; ABRE; napA; 2S; XX OS Brassica napus; XX RA Stalberg K, Ellerstom M, Ezcurra I, Ablov S, Rask L RT Disruption of an overlapping E-box/ABRE motif abolished high RT transcription of the napA storage-protein promoter in transgenic RT Brassica napus seeds RL Planta 199:515-519 (1996) XX SQ CAAACAC // ID 3AF1BOX1 XX AC S000004 XX DT 26-Dec-1991 (created) kehi; 27-Jul-1997 (last modified) kehi XX DE "3AF1 binding site"; tetramer in the light-responsive promoter of DE pea rbcS-3A gene; "Box VI"; XX KW 3AF1 box; promoter XX OS pea XX RA Lam E, Kano-Murakami Y, Gilmartin P, Niner B, Chua N-H RT A metal-dependent DNA-binding protein interacts with a RT constitutive element of a light-responsive promoter RL Plant Cell 2:857-866 (1990) RD PMID: 2152132, MUID: 93005678 XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes RL Plant Cell 2:369-378 (1990) XX SQ AAATAGATAAATAAAAACATT // ID ABADESI1 XX AC S000007 XX DT 28-Jan-1994 (created) kehi; 27-Jul-1997 (last modified) kehi XX DE Responsive to ABA and desiccation; "Motif I" of rice rab16A-D DE (initially called rab-21); Expressed in seeds late during DE embryogenesis, induced by ABA and osmotic stress in vegetative DE tissues; Contains ACGT motif; transacting factor: TAF-1; XX KW rab16; ABA; ABRE; TAF-1; ACGT; XX OS rice; plant; XX RA Mundy J, Yamaguchi-Shinozaki K, Chua N-H RT Nuclear proteins bind conserved elements in the abscisic RT acid-responsive promoter of a rice rab gene RL Proc Natl Acad Sci USA 87:1406-1410 (1990) RC Gel retardation; DNase I cleavage inhibition; RD PMID: 2137613, MUID: 90160337 XX RA Oeda K, Salinas J, Chua N-H RT A tobacco bZip transcription activator (TAF-1) binds to a RT G-box-like motif conserved in plant genes RL EMBO J 10:1793-1802 (1991) RD PMID: 2050116, MUID: 91266908 XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview RL Plant Cell 5:1401-1410 (1993) RC Review RD PMID: 8281041, MUID: 94108263 XX SQ RTACGTGGCR //