ID -10PEHVPSBD XX AC S000392 XX DT 20-Feb-2002 (last modified) uchi XX DE "-10 promoter element" found in the barley (H.v.) chloroplast DE psbD gene promoter; Involved in the expression of the plastid DE gene psbD which encodes a photosystem II reaction center DE chlorophyll-binding protein that is activated by blue, white or DE UV-A light; XX KW psbD; chloroplast gene expression; circadian rhythms; light KW regulation; XX OS barley (Hordeum vulgare) XX RA Thum KE, Kim M, Morishige DT, Eibl C, Koop HU, Mullet JE RT Analysis of barley chloroplast psbD light-responsive promoter RT elements in transplastomic tobacco RL Plant Mol Biol 47: 353-366 (2001) RD PubMed: 11587507; XX SQ TATTCT // ID -141NTG13 XX AC S000335 XX DT 16-Feb-2001 (last modified) seki XX DE "-141 sequence"; Binding site of tobacco (N.t.) TGA1a-related DE protein,PG13, found in the G13 gene promoter; PG13 (Protein DE encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and DE TGA1a bind to the same target sequence in the 5' upstream region DE of G13 suggesting that autoregulation of transcription may DE involved in the control of G13 expression; TGA1a is DE preferentially expressed in root tip meristems; TGA1a may DE contribute to the expression of GST isoenzymes, especially in DE root tip meristems; XX KW TGA1a; G13; ASF1; ASF-1; bZip; xenobiotic stress; root; KW meristem; XX OS tobacco (Nicotiana tabacum) XX RA Fromm H, Katagiri F, Chua NH RT The tobacco transcription activator TGA1a binds to a sequence in RT the 5' upstream region of a gene encoding a TGA1a-related RT protein RL Mol Gen Genet 229: 181-188 (1991) RD PubMed: 1921969; GenBank: M62855; XX RA Klinedinst S, Pascuzzi P, Redman J, Desai M, Arias J RT A xenobiotic-stress-activated transcription factor and its RT cognate target genes are preferentially expressed in root tip RT meristems RL Plant Mol Biol 42: 679-688 (2000) RD PubMed: 10809441; XX SQ GCTTTTGATGACTTCAAACAC // ID -284MOTIFZMSBE1 XX AC S000285 XX DT 10-Feb-2000 (last modified) seki XX DE Located between -284 and -255 region of maize (Z.m.) Sbe1 gene DE promoter; Critical positive cis element; Important for the DE high-level, sugar-responsive expression of the Sbe1 gene in maize DE endosperm cells; Recognized by nuclear protein; See S000284; XX KW Starch-branching enzyme (Sbe1); starch; kernel; sugar; endosperm; KW seed; XX OS maize (Zea mays) XX RA Kim K-N, Guiltinan MJ RT Identification of cis-acting elements important for expression of RT the starch-branching enzyme I gene in Maize endosperm RL Plant Physiol 121: 225-236 (1999) RD PubMed: 10482678 XX SQ CGTGCAAGCCCAAAGGCCAATCGGCCCAGA // ID -300CORE XX AC S000001 XX DT 10-May-2006 (last modified) kehi XX DE "TGTAAAG core motif" in "-300 elements" of alpha-zein genes of DE maize; "-300 element core"; "prolamin box" by Vicente-Carbajosa DE et al. (Proc Natl Acad Sci USA 94:7685 (1997)); P-box; Binds with DE P-box binding factor (PBF); Binds with BPBF (Barley PBF); PBF is DE a DNA-binding protein of the DOF class of transcription factors; XX KW zein; core motif; maize; -300 element; promoter; prolamin-box; KW P-box; seed; endosperm; XX OS maize (Zea mays); wheat (Triticum aestivum); barley (Hordeum OS vulgare); tobacco (Nicotiana tabacum) XX RA Forde BG, Heyworth A, Pywell J, Kreis M RT Nucleotide sequence of a B1 hordein gene and the identification RT of possible upstream regulatory elements in endosperm storage RT protein genes from barley, wheat and maize. RL Nucleic Acids Res 13:7327-7339 (1985) RD PubMed: 4059057; GenBank: X03103; XX RA Colot V, Robert LS, Kavanagh TA, Bevan MW, Thompson RD RT Localization of sequences in wheat endosperm protein genes which RT confer tissue-specific expression in tobacco. RL EMBO J 6:3559-3564 (1987) RD PubMed: 15467781 XX RA Thomas MS, Flavell RB RT Identification of an enhancer element for the endosperm-specific RT expression of high molecular weight glutenin. RL Plant Cell 2:1171-1180 (1990) RD PubMed: 2152160; XX RA Thompson GA, Boston RS, Lyznik LA, Hodges TK, Larkins BA RT Analysis of promoter activity from an alpha-zein gene 5' flanking RT sequence in transient expression assays. RL Plant Mol Biol 15:755-764 (1990) RD PubMed: 2102884; XX RA Vicente-Carbajosa J, Moose SP, Parsons RL, Schmidt R RT A maize zinc-finger protein binds the prolamin box in zein gene RT promoters and interacts with the basic leucine zipper RT transcriptional activator Opaque2. RL Proc Natl Acad Sci USA 94:7685-7690 (1997) RD PubMed: 9207153; GenBank: U82230; XX RA Mena M, Vicente-Carbajosa J, Schmidt RJ, Carbonero P RT An endosperm-specific DOF protein from barley, highly conserved RT in wheat, binds to and activates transcription from the RT prolamin-box of a native B-hordein promoter in barley endosperm RL Plant J 16:53-62 (1998) RD PubMed: 9807827; GenBank: AJ012284, AJ000991 XX RA Singh KB RT Transcriptional regulation in plants: the importance of RT combinatorial control. RL Plant Physiol 118: 1111-1120 (1998) RC review RD PubMed: 9847085 XX SQ TGTAAAG // ID -300ELEMENT XX AC S000122 XX DT 11-May-2006 (last modified) kehi XX DE Present upstream of the promoter from the B-hordein gene of DE barley and the alpha-gliadin, gamma-gliadin, and low molecular DE weight glutenin genes of wheat; See S000001 -300CORE; See S000002 DE -300MOTIF; XX KW -300 element; hordein; gliadin; glutenin; seed; XX OS wheat (Triticum aestivum) XX RA Kreis M, Williamson MS, Forde J, Schmitz D, Clark J, Buxton B, RA Pywell J, Marris C, Henderson J, Harris N, Shewry PR, Forde BG, RA Miflin BJ RT Differential gene expression in the developing barley endosperm. RL Philos Trans R Soc Lond B314:355-365 (1986) XX RA Colot V, Robert LS, Kavanagh TA, Bevan MW, Thompson RD RT Localization of sequences in wheat endosperm protein genes which RT confer tissue-specific expression in tobacco. RL EMBO J 6:3559-3564 (1987) RD PubMed: 15467781 XX RA Thomas MS, Flavell RB RT Identification of an enhancer element for the endosperm-specific RT expression of high molecular weight glutenin. RL Plant Cell 2:1171-1180 (1990) RD PubMed: 2152160; XX SQ TGHAAARK // ID -300MOTIFZMZEIN XX AC S000002 XX DT 17-May-1998 (last modified) kehi XX DE Motif in -300 elements of alpha-zein genes of maize (Z.m.); DE homologous to the sequence to which transacting factors of AP-1, DE fos, jun or yeast hisS bind; XX KW zein; core motif; maize; -300 element; seed; endosperm; XX OS maize (Zea mays) XX RA Thomas MS, Flavell RB RT Identification of an enhancer element for the endosperm-specific RT expression of high molecular weight glutenin. RL Plant Cell 2:1171-1180 (1990) RD PubMed: 2152160; XX SQ RTGAGTCAT // ID -314MOTIFZMSBE1 XX AC S000284 XX DT 10-Feb-2000 (last modified) seki XX DE Located between -314 and -295 region of maize (Z.m.) Sbe1 gene DE promoter; Critical positive cis element; Important for the DE high-level, sugar-responsive expression of the Sbe1 gene in maize DE endosperm cells; Recognized by nuclear protein; See S000285; XX KW Starch-branching enzyme (Sbe1); kernel; sugar; endosperm; seed; XX OS maize (Zea mays) XX RA Kim K-N, Guiltinan MJ RT Identification of cis-acting elements important for expression of RT the starch-branching enzyme I gene in maize endosperm RL Plant Physiol 121: 225-236 (1999) RD PubMed: 10482678 XX SQ ACATAAAATAAAAAAAGGCA // ID 14BPATERD1 XX AC S000412 XX DT 03-Jun-2003 (last modified) kehi XX DE "14 bp region" (from -599 to -566) necessary for expression of DE erd1 (early responsive to dehydration) in dehydrated DE Arabidopsis; XX KW water-stress; erd; XX OS Arabidopsis thaliana XX RA Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, RA Yamaguchi-Shinozaki K. RT Two different novel cis-acting elements of erd1, a clpA RT homologous Arabidopsis gene function in induction by dehydration RT stress and dark-induced senescence. RL Plant J. 33: 259-270 (2003) RD PubMed: 12535340; XX SQ CACTAAATTGTCAC // ID 20NTNTNOS XX AC S000312 XX DT 7-Sep-2000 (last modified) seki XX DE "20nt (20 nucleotide sequence)" found in the promoter on tobacco DE (N.t.) nopalin synthase (nos) gene promoter; Containing two DE hexamer motifs (TGAGCT) and a spacer region; The spacer region DE between two hexamer motifs is essential; Important for the gene DE expression; Essential for response to wounding, auxin, MJ, and DE SA; Very similar to ASF-1 binding site (See S000073); See DE S000053(ACGTCA); XX KW nopalin synthase; nos; auxin; wounding; methyl jasmonate; XX OS tobacco (Nicotiana tabacum) XX RA Kim Y, Buckley K, Costa MA, An G RT A 20 nucleotide upstream element is essential for the nopaline RT synthase (nos) promoter activity RL Plant Mol Biol 24:105-117 (1994) RD PubMed: 8111010; XX SQ TGAGCTAAGCACATACGTCA // ID 23BPUASNSCYCB1 XX AC S000283 XX DT 10-Feb-2000 (last modified) seki XX DE "23 bp UAS (Upstream activating sequence)" found in the promoter DE of Nicotiana sylvestris (N.s.) CycB1 gene; Located between -386 DE and -409; Contains a 5 bp element identical to the MYB binding DE core (ACGT); Required for M-phase-specific expression; Binds DE protein complexes in a cell cycle-regulated manner; XX KW B-type cyclins; MYB; Cell cycle; M-phase; XX OS tobacco (Nicotiana sylvestris) XX RA Trehin C, Glab N, Perennes C, Planchais S, Bergounioux C RT M phase-specific activation of the Nicotiana sylvestris Cyclin B1 RT promoter involves multiple regulatory elements RL Plant J 17: 263-273 (1999) XX SQ TTTATTTACCAAACGGTAACATC // ID 23BPZM27KDAZEIN XX AC S000341 XX DT 7-Sep-2000 (last modified) seki XX DE 23 bp sequence found in the maize (Z.m.) gamma-class 27kDa zein DE gene promoter; Contains -300 element (also called the endosperm DE box or prolamin box); Binding site of nuclear protein; Confers a DE high level of transcriptional activity in an DE orientation-dependent manner; -300 element is involved in the DE common regulatory mechanisms mediating the coordinated expression DE of the zein genes; XX KW gamma-class 27kDa zein; -300 element; prolamin box; endosperm KW box; seed; XX OS maize (Zea mays) XX RA Ueda T, Wang Z, Pham N, Messing J RT Identification of a transcriptional activator-binding element in RT the 27-kilodalton zein promoter, the -300 element RL Mol Cell Biol 14: 4350-4359 (1994) RD PubMed: 8007944; XX SQ GACGTGTAAAGTAAATTTACAAC // ID 27BPDRCONSENSUSPS25S XX AC S000286 XX DT 10-Feb-2000 (last modified) seki XX DE The consensus sequence of 27 bp imperfect repeats found in the DE untrascribed spacer close to the 3'end of the pea (P.s.) 25S DE gene; Involved in the rDNA replication fork barrier; Nuclear DE protein(s) specifically bound to this repeat; W=T/A; M=A/C; XX KW rDNA; 25S; tandem repeat; fork barrier; XX OS pea (Pisum sativum) XX RA Lopez-Estrano C, Schivartzman JB, Krimer DB, Hernandez P RT Characterization of the pea rDNA replication fork barrier: RT putative cis-acting and trans-acting factors RL Plant Mol Biol 40: 99-110 (1999) RD PubMed: 10394949 XX SQ TCCGCCWCTTGTATTCGTTGCGTTGMA // ID 2SSEEDPROTBANAPA XX AC S000143 XX DT 10-May-1998 (last modified) kehi XX DE Conserved in many storage-protein gene promoters; May be DE important for high activity of the napA promoter; XX KW storage protein; ABRE; napA; 2S; seed; XX OS Brassica napus; XX RA Stalberg K, Ellerstom M, Ezcurra I, Ablov S, Rask L RT Disruption of an overlapping E-box/ABRE motif abolished high RT transcription of the napA storage-protein promoter in transgenic RT Brassica napus seeds. RL Planta 199:515-519 (1996) RD PubMed: 8818291; XX SQ CAAACAC // ID 3AF1BOXPSRBCS3 XX AC S000004 XX DT 17-May-1998 (last modified) kehi XX DE "3AF1 binding site"; tetramer in the light-responsive promoter of DE pea (P.s.) rbcS-3A gene; "Box VI"; One of "AT-rich sequences" DE which have been found in numerous light-regulated promoters DE (Terzaghi & Cashmore, 1995); 3AF1 site includes a GATA motif; XX KW 3AF1 box; promoter; AT-rich sequences; GATA; rbcs; rbcs-3; leaf; KW shoot; XX OS pea (Pisum sativum) XX RA Lam E, Kano-Murakami Y, Gilmartin P, Niner B, Chua N-H RT A metal-dependent DNA-binding protein interacts with a RT constitutive element of a light-responsive promoter. RL Plant Cell 2:857-866 (1990) RD PubMed: 2152132; GenBank: X62746; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ AAATAGATAAATAAAAACATT // ID 5256BOXLELAT5256 XX AC S000279 XX DT 27-Feb-2000 (last modified) kehi XX DE "52/56 box"; A sequence motif shared between the tomato (L.e.) DE LAT(Late Anther Tomato)52 and LAT56 promoters; Encompassing "PB DE core motif" (TGTGGTT), and is closely related to the box II DE sequence motif in the pea rbcS-3A gene promoter; Involved in DE modulating the activity of the LAT gene promoters in pollen; DE Dispensable for the developmental regulation of the LAT52 gene in DE pollen; 52/56 box may be a target for the binding of a member of DE the GT-1 transcription factor family; XX KW 52/56; lat; lat52; lat56; GT-1; pollen; anther; XX OS tomato (Lycopersicon esculentum) XX RA Twell D, Yamaguchi J, Wing RA, Ushiba J, McCormick S RT Promoter analysis of genes that are coordinately expressed during RT pollen development reveals pollen-specific enhancer sequences and RT shared regulatory elements RL Genes Dev 5:496-507 (1991) RD PubMed: 1840556; GenBank: X56487; XX RA Eyal Y, Curie C, McCormick S RT Pollen specificity elements reside in 30 bp of the proximal RT promoters of two pollen-expressed genes RL Plant Cell 7:373-384 (1995) RD PubMed: 7734969; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ TGTGGTTATATA // ID 5659BOXLELAT5659 XX AC S000280 XX DT 29-Sep-2003 (last modified) kehi XX DE "56/59 box"; A sequence motif shared between the tomato (L.e.) DE LAT(Late Anther Tomato)56 and LAT59 promoters; Found in -103 to DE -94 in LAT56 and in -114 to -105 in LAT59; Involved in modulating DE the activity of the LAT gene promoters in pollen; W=A/T; XX KW 56/59; lat; lat56; lat59; GT-1; pollen; anther; XX OS tomato (Lycopersicon esculentum) XX RA Twell D, Yamaguchi J, Wing RA, Ushiba J, McCormick S RT Promoter analysis of genes that are coordinately expressed during RT pollen development reveals pollen-specific enhancer sequences and RT shared regulatory elements RL Genes Dev 5:496-507 (1991) RD PubMed: 1840556; GenBank: X56488; XX RA Eyal Y, Curie C, McCormick S RT Pollen specificity elements reside in 30 bp of the proximal RT promoters of two pollen-expressed genes RL Plant Cell 7:373-384 (1995) RD PubMed: 7734969; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ GAAWTTGTGA // ID AACACOREOSGLUB1 XX AC S000353 XX DT 16-Feb-2001 (last modified) seki XX DE Core of AACA motifs found in rice (O.s.) glutelin genes, involved DE in controlling the endosperm-specific expression; AACA is also DE closely associated with the GCN4 motif in all rice glutelin genes DE and together have been shown to confer endosperm-specific DE enhancement to the truncated -90 CaMV 35S promoter; See also DE S000045, S000181, S000276; XX KW glutelin; AACA; GCN4; seed; endosperm; XX OS rice (Oryza sativa) XX RA Wu C, Washida H, Onodera Y, Harada K, Takaiwa F RT Quantitative nature of the Prolamin-box, ACGT and AACA motifs in RT a rice glutelin gene promoter: minimal cis-element requirements RT for endosperm-specific gene expression RL Plant J 23: 415-421 (2000) RD PubMed: 10929134; XX SQ AACAAAC // ID AACAOSGLUB1 XX AC S000276 XX DT 15-Oct-1999 (last modified) kehi XX DE "AACA motif" found in GluB-1 gene in rice (O.s.); Required for DE endosperm-specific expression; Highly conserved in the DE 5'-flanking region of glutelin genes; See S000277; XX KW GluB-1; glutelin; endosperm; seed; storage protein; AACA motif; XX OS rice (Oryza sativa) XX RA Washida H, Wu CY, Suzuki A, Yamanouchi U, Akihama T, Harada K, RA Takaiwa F RT Identification of cis-regulatory elements required for endosperm RT expression of the rice storage protein glutelin gene GluB-1 RL Plant Mol Biol 40:1-12 (1999) RD PubMed: 10394940; XX SQ CAACAAACTATATC // ID AAGACGTAGATACL12 XX AC S000344 XX DT 7-Sep-2000 (last modified) seki XX DE Sequence found in Arabidopsis (A.t.) acyl carrier protein (ACP), DE Acl1.2, gene promoter; Contains bZIP core motif (ACGT); XX KW Acl1.2; bZIP; acyl carrier protein; XX OS Arabidopsis thaliana XX RA Baerson SR, Vander Heiden MG, Lamppa GK RT Identification of domains in an Arabidopsis acyl carrier protein RT gene promoter required for maximal organ-specific expression RL Plant Mol Biol 26: 1947-1959 (1994) RD PubMed: 7858229; XX SQ AAGACGTAG // ID ABADESI1 XX AC S000007 XX DT 10-Feb-2000 (last modified) seki XX DE Responsive to ABA and desiccation; "Motif I" of rice rab16A-D DE (initially called rab-21); Expressed in seeds late during DE embryogenesis; Induced by ABA and osmotic stress in vegetative DE tissues; Contains ACGT motif; transacting factor: TAF-1; XX KW rab16; ABA; ABRE; TAF-1; ACGT; Motif i; seed; embryo; XX OS rice (Oryza sativa) XX RA Mundy J, Yamaguchi-Shinozaki K, Chua N-H RT Nuclear proteins bind conserved elements in the abscisic RT acid-responsive promoter of a rice rab gene. RL Proc Natl Acad Sci USA 87:1406-1410 (1990) RC Gel retardation; DNase I cleavage inhibition; RD PubMed: 2137613; XX RA Oeda K, Salinas J, Chua N-H RT A tobacco bZip transcription activator (TAF-1) binds to a RT G-box-like motif conserved in plant genes. RL EMBO J 10:1793-1802 (1991) RD PubMed: 2050116; GenBank: X60363; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Skriver K, Mundy J RT Gene expression in response to abscisic acid and osmotic stress RL Plant Cell 2: 503-512 (1990) RC review RD PubMed: 2152172 XX SQ RTACGTGGCR // ID ABADESI2 XX AC S000008 XX DT 29-Sep-1999 (last modified) kehi XX DE Synthetic element (hex-3) related to response to ABA and to DE desiccation; seed expression; Gene: synthetic; hex-3, mutant of DE hex-1 sequence from wheat histone H3 promoter; transacting DE factor: bZIP ?; XX KW ABA; SEED; bZIP; hex-1; hex-3; histone; XX OS rice (Oryza sativa); wheat (Triticum aestivum) XX RA Lam E, Chua N-H RT Tetramer of a 21-base pair synthetic element confers seed RT expression and transcriptional enhancement in response to water RT stress and abscisic acid. RL J Biol Chem 266:17131-17135 (1991) RD PubMed: 1832669; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810 XX SQ GGACGCGTGGC // ID ABAREG2 XX AC S000009 XX DT 29-Sep-1999 (last modified) kehi XX DE Motif related to ABA regulation; Gene: sunflower helianthinin; DE transacting factor: bZIP ? XX KW ABA; bZIP; seed; XX OS sunflower (Helianthus annuus) XX RA Nunberg A, Li Z, Bogue M, Vivekananda J, Reddy A, Thomas TL RL unpublished results (cited in a review by Thomas TL, 1993) XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810 XX SQ ATGTACGAAGC // ID ABASEED1 XX AC S000011 XX DT 29-Sep-1999 (last modified) kehi XX DE ABA regulation; seed expression; Gene: carrot Dc3; Transacting DE factor: bZIP ?; Contains ACGT motif; XX KW Dc3; ABA; ABRE; bZIP; seed; ACGT; XX OS carrot (Daucus carota) XX RA Chung H, Thomas TL RL unpublished results (cited in a review by Thomas TL, 1993) XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810 XX SQ TGTTACGTGCC // ID ABFOS XX AC S000190 XX DT 11-Oct-1999 (last modified) kehi XX DE ABF (as-1-like box binding factor) binding site; as-1-like (ASL) DE box is found at -98 to -79 of RTBV (rice tungro bacilliform DE virus) promoter; ASL box is required for phloem-specific gene DE expression of Rice Tungro Bacilliform Virus (RTBV); See also DE RNFG1OS (S000188), and RNFG2OS (S000189); See as-1 (S000023); XX KW ASL; as-1; phloem; RTBV; ABF; stem; phloem; XX OS RTBV; rice tungro bacilliform virus; rice (Oryza sativa); XX RA Yin Y, Chen L, Beachy R RT Promoter elements required for phloem-specific gene expression RT from the RTBV promoter in rice RL Plant J 12:1179-1188 (1997) RD PubMed: 9418055; XX SQ GCATCTTTACTTTAGCATC // ID ABRE2HVA1 XX AC S000134 XX DT 29-Sep-1999 (last modified) kehi XX DE ABA responsive element, ABRE2, found in barley (H.v.) HVA1 gene DE encoding a class 3 late embryogenesis-abundant protein; stress DE response; XX KW ABRE; ABA; HVA1; ABRE2; seed; embryo; XX OS barley (Hordeum vulgare); XX RA Straub PF, Shen Q, Ho THD RT Structure and promoter analysis of an ABA- and stress-regulated RT barley gene, HVA1. RL Plant Mol Biol 26:617-630 (1994) RD PubMed: 7948917; GenBank: X78205; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CCTACGTGGCGG // ID ABRE2HVA22 XX AC S000117 XX DT 29-Sep-1999 (last modified) kehi XX DE "ABRE2" of barley HVA22 gene; G-box; component of ABA response DE complex in HVA22 gene; see S0118 (ABRE3 of HVA22 gene); see CE1 DE (coupling element 1 = TGCCACCGG); See S000014; XX KW ABRE; G-box; coupling element; CE1; HVA22; XX OS barley (Hordeum vulgare); XX RA Shen Q, Ho TH RT Functional dissection of an abscisic acid(ABA)-inducible gene RT reveals two independent ABA-responsive complexes each containing RT a G-box and a novel cis-acting element. RL Plant Cell 7:295-307 (1995) RD PubMed: 7734964; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CGCACGTGTC // ID ABRE3HVA1 XX AC S000135 XX DT 29-Sep-1999 (last modified) kehi XX DE ABA responsive element, ABRE3, found in barley (H.v.) HVA1 gene DE encoding a class 3 late embryogenesis-abundant protein; stress DE response; XX KW ABRE; ABA; HVA1; ABRE3; seed; embryo; XX OS barley (Hordeum vulgare); XX RA Straub PF, Shen Q, Ho THD RT Structure and promoter analysis of an ABA- and stress-regulated RT barley gene, HVA1. RL Plant Mol Biol 26:617-630 (1994) RD PubMed: 7948917; GenBank: X78205; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ GCAACGTGTC // ID ABRE3HVA22 XX AC S000118 XX DT 17-May-2001 (last modified) uchi XX DE "ABRE3" of barley HVA22 gene; Newly designated "A3" by Shen et DE al., Plant Cell 8:1107 (1996); G-box; component of ABA response DE complex in HVA22 gene; see S0117 (ABRE2 of HVA22 gene); see CE1 DE (coupling element 1 = TGCCACCGG); See S000014; ABA response DE complex 1(ABRC1)=A3(previously designated ABRE3)+CE1 (Shen et DE al., Plant Cell 8:1107(1996)); XX KW ABRE; G-box; coupling element; CE1; HVA22; XX OS barley (Hordeum vulgare); XX RA Shen Q, Ho THD RT Functional dissection of an abscisic acid(ABA)-inducible gene RT reveals two independent ABA-responsive complexes each containing RT a G-box and a novel cis-acting element. RL Plant Cell 7:295-307 (1995) RD PubMed: 7734964; XX RA Shen Q, Zhang P, Ho THD RT Modular nature of abscisic acid (ABA) response complexes: RT composite promoter units that are necessary and sufficient for RT ABA induction of gene expression in barley. RL Plant Cell 8:1107-1119 (1996) RD PubMed: 8768371; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Singh KB RT Transcriptional Regulation in Plants: The Importance of RT Combinatorial Comtrol RL Plant Physiol 118: 1111-1120 RC review XX SQ GCCACGTACA // ID ABRE3OSRAB16 XX AC S000120 XX DT 29-Sep-1999 (last modified) kehi XX DE ABA-responsive element of rice (O.s.) rab16 and alpha-amylase DE genes; XX KW ABA; rab16; alpha-amylase; ABRE; seed; XX OS rice (Oryza sativa); XX RA Skriver K, Olsen FL, Rogers JC, Mundy J RT Cis-acting DNA elements responsive to gibberellin and its RT antagonist abscisic acid. RL Proc Natl Acad Sci USA 88:7266-7270 (1991) RD PubMed: 1831269; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ GTACGTGGCGC // ID ABREA2HVA1 XX AC S000140 XX DT 17-May-2001 (last modified) uchi XX DE A2 of ABRC3; ABRC3 (ABA response complex 3) of HVA1 consists of DE CE3 and A2; ABA responsive element; stress response; Found in DE barley HVA1 gene encoding a class 3 late embryogenesis-abundant DE (Lea) protein; ABRC1 OF HVA22 consists of CE1 and A3; DE CE1=S000014; A3=ABRE3=S000118; See S000118; XX KW A2; ABRC3; ABRE; ABA; HVA1; Lea; seed; XX OS barley (Hordeum vulgare) XX RA Shen Q, Zhang P, Ho THD RT Modular nature of abscisic acid (ABA) response complexes: RT composite promoter units that are necessary and sufficient for RT ABA induction of gene expression in barley. RL Plant Cell 8:1107-1119 (1996) RD PubMed: 8768371; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CCTACGTGGC // ID ABREATCONSENSUS XX AC S000406 XX DT 06-January-2006 (last modified) kehi XX DE ABA-responsive elements (ABREs) found in the promoter of ABA DE and/or stress-regulated genes; ABFs, a family of ABRE binding DE factors; ABF3 and ABF4 function in ABA signaling; Y=C/T; XX KW ABA; ABF; bZIP factors; XX OS Arabidopsis thaliana XX RA Choi H, Hong J, Ha J, Kang J, Kim SY RT ABFs, a family of ABA-responsive element binding factors RL J Biol Chem. 275: 1723-1730 (2000) RD PubMed: 10636868; XX RA Kang JY, Choi HI, Im MY, Kim SY RT Arabidopsis basic leucine zipper proteins that mediate RT stress-responsive abscisic acid signaling RL Plant Cell. 14: 343-357 (2002) RD PubMed: 11884679; XX RA Oh SJ, Song SI, Kim YS, Jang HJ, Kim SY, Kim M, Kim YK, Nahm BH, RA Kim JK. RT Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased RT tolerance to abiotic stress without stunting growth. RL Plant Physiology 138: 341-351 (2005) RD PubMed: 15834008 XX RA Choi HI, Park HJ, Park JH, Kim S, Im MY, Seo HH, Kim YW, Hwang I, RA Kim SY. RT Arabidopsis Calcium-Dependent Protein Kinase AtCPK32 Interacts RT with ABF4, a Transcriptional Regulator of Abscisic RT Acid-Responsive Gene Expression, and Modulates Its Activity. RL Plant Physiol. 139: 1750-1761(2005) RD PubMed: 16299177 XX SQ YACGTGGC // ID ABREATRD22 XX AC S000013 XX DT 29-Sep-1999 (last modified) kehi XX DE "ABRE (ABA responsive element)" in Arabidopsis (A.t.) DE dehydration-responsive gene rd22; R=A/G; Y=C/T; XX KW ABA; responsive element; ABRE; rd22; RD22; dehydration; shoot; XX OS Arabidopsis thaliana XX RA Iwasaki T, Yamaguchi-Shinozaki K,Shinozaki K RT Identification of a cis-regulatory region of a gene in RT Arabidopsis thaliana whose induction by dehydration is mediated RT by abscisic acid and requires protein synthesis. RL Mol Gen Genet 247:391-398 (1995) RD PubMed: 7770045; XX RA Bray EA RT Plant responses to water deficit RL Trends in Plant Science 2:48-54 (1997) XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ RYACGTGGYR // ID ABREAZMRAB28 XX AC S000218 XX DT 11-May-2006 (last modified) kehi XX DE ABA-responsive element (ABRE A) found at -148 to -139 in maize DE rab28 (Busk & Pages, 1997); Maize rab28 is ABA-inducible in DE embryos and vegetative tissues; XX KW ABA; ABRE; rab28; seed; shoot; XX OS maize (Zea mays) XX RA Busk PK, Pages M RT Protein binding to the abscisic acid-responsive element is RT independent of VIVIPAROUS1 in vivo RL Plant Cell 9:2261-2270 (1997) RD PubMed: 11407411 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ GCCACGTGGG // ID ABREBNNAPA XX AC S000145 XX DT 16-Feb-2001 (last modified) seki XX DE ABRE of napA storage-protein gene of Brassica napus (B.n.); ABA DE responsive element; dist B ABRE mediated transactivation by ABI3 DE adn ABI3-dependent response to ABA; a tetramer of the composite DE RY/G complex mediated only ABA-independent transactivation by DE ABI3; B2 domain of ABI3 is necessary for ABA-independent and DE ABA-dependent activation through the dist B ABRE; B3 domain of DE ABI3 interacts with the RY/G complex; XX KW napA; storage protein; ABRE; napin; seed; XX OS Brassica napus; XX RA Stalberg K, Ellerstom M, Ezcurra I, Ablov S, Rask L RT Disruption of an overlapping E-box/ABRE motif abolished high RT transcription of the napA storage-protein promoter in transgenic RT Brassica napus seeds. RL Planta 199:515-519 (1996) RD PubMed: 8818291; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M, Rask L RT Transactivation of the Brassica napus napin promoter by ABI3 RT requires interaction of the conserved B2 and B3 domains of ABI3 RT with different cis-elements: B2 mediates activation through an RT ABRE, whereas B3 interacts with an RY/G-box RL Plant J 24:57-66 (2000) RD PubMed: 11029704; XX SQ CGCCACGTGTCC // ID ABREBZMRAB28 XX AC S000219 XX DT 11-May-2006 (last modified) kehi XX DE ABA-responsive element (ABRE B) found at -105 to -96 in maize DE (Z.m.) rab28 (Busk & Pages, 1997); Maize rab28 is ABA-inducible DE in embryos and vegetative tissues; XX KW ABA; ABRE; rab28; embryo; seed; shoot; XX OS maize (Zea mays) XX RA Busk PK, Pages M RT Protein binding to the abscisic acid-responsive element is RT independent of VIVIPAROUS1 in vivo RL Plant Cell 9:2261-2270 (1997) RD PubMed: 11407411 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ TCCACGTCTC // ID ABRECE1HVA22 XX AC S000014 XX DT 03-Jun-2003 (last modified) kehi XX DE CE1(coupling element 1) of barley HVA22 gene; possible binding DE site for nuclear bZIP protein; ABA responsive complex consists of DE a G-box, namely ABRE3 (GCCACGTACA), and CE1; XX KW ABA; CE1; bZIP; G box; G-box; ABRE; shoot; XX OS barley (Hordeum vulgare) XX RA Shen Q, Ho TH RT Functional dissection of an abscisic acid(ABA)-inducible gene RT reveals two independent ABA-responsive complexes each containing RT a G-box and a novel cis-acting element. RL Plant Cell 7:295-307 (1995) RD PubMed: 7734964; XX RA Bray EA RT Plant responses to water deficit RL Trends in Plant Science 2:48-54 (1997) XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Casaretto J, Ho TH. RT The transcription factors HvABI5 and HvVP1 are required for the RT abscisic acid induction of gene expression in barley aleurone RT cells. RL Plant Cell 15: 271-284 (2003) RD PubMed: 12509536; XX SQ TGCCACCGG // ID ABRECE3HVA1 XX AC S000141 XX DT 03-jun-2003 (last modified) kehi XX DE CE3 (coupling element 3) of ABRC3 in barley HVA1 gene; ABRC3 (ABA DE response complex 3) of HVA1 consists of CE3 and A2; ABA DE responsive element; stress response; Found in barley HVA1 gene DE encoding a class 3 late embryogenesis-abundant (Lea) protein; DE ABRC1 OF HVA22 consists of CE1 and A3; CE1=S000014; DE A3=ABRE3=S000118; See S000118; XX KW CE3; coupling element; ABRC3; ABRE; ABA; HVA1; Lea; seed; XX OS barley (Hordeum vulgare); XX RA Shen Q, Zhang P, Ho THD RT Modular nature of abscisic acid (ABA) response complexes: RT composite promoter units that are necessary and sufficient for RT ABA induction of gene expression in barley. RL Plant Cell 8:1107-1119 (1996) RD PubMed: 8768371; XX RA Bray EA RT Plant responses to water deficit RL Trends in Plant Science 2:48-54 (1997) XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Casaretto J, Ho TH. RT The transcription factors HvABI5 and HvVP1 are required for the RT abscisic acid induction of gene expression in barley aleurone RT cells. RL Plant Cell 15: 271-284 (2003) RD PubMed: 12509536; XX SQ ACGCGTGTCCTC // ID ABRECE3ZMRAB28 XX AC S000221 XX DT 11-May-2006 (last modified) kehi XX DE CE3 (coupling element 3) in maize (Z.m.) rab28 gene promoter; ABA DE responsive element; stress response; Similar (10 of 12) to CE3 in DE A1 gene of barley; See S000141 (ABRECE3HVA1); Found at -126 to DE -115; XX KW CE3; coupling element; RAB28; rab; ABRE; ABA; seed; XX OS maize (Zea mays) XX RA Busk PK, Pages M RT Protein binding to the abscisic acid-responsive element is RT independent of VIVIPAROUS1 in vivo RL Plant Cell 9:2261-2270 (1997) RD PubMed: 11407411 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ ACGCGCCTCCTC // ID ABREDISTBBNNAPA XX AC S000262 XX DT 16-Feb-2001 (last modified) seki XX DE "dist B (distal portion of B-box)" found in napA gene of Brassica DE napus (B.n.); Shows similarity to ABRE; Found between -148 and DE -124; Required for seed specific expression and ABA DE responsiveness; See S000263, S000264; dist B ABRE mediated DE transactivation by ABI3 adn ABI3-dependent response to ABA; a DE tetramer of the composite RY/G complex mediated only DE ABA-independent transactivation by ABI3; B2 domain of ABI3 is DE necessary for ABA-independent and ABA-dependent activation DE through the dist B ABRE; XX KW ABRE; ABA; distB; B-box; seed; napA; napin; XX OS Brassica napus XX RA Ezcurra I, Ellerstrom M, Wycliffe P, Stalberg K, Rask L RT Interaction between composite elements in the napA promoter: both RT the B-box ABA-responsive complex and the RY/G complex are RT necessary for seed-specific expression RL Plant Mol Biol 40:699-709 (1999) RD PubMed: 10480393; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RD PubMed: 9617810; XX RA Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M, Rask L RT Transactivation of the Brassica napus napin promoter by ABI3 RT requires interaction of the conserved B2 and B3 domains of ABI3 RT with different cis-elements: B2 mediates activation through an RT ABRE, whereas B3 interacts with an RY/G-box RL Plant J 24:57-66 (2000) RD PubMed: 11029704; XX SQ GCCACTTGTC // ID ABRELATERD1 XX AC S000414 XX DT 01-August-2006 (last modified) kehi XX DE ABRE-like sequence (from -199 to -195) required for DE etiolation-induced expression of erd1 (early responsive to DE dehydration) in Arabidopsis; XX KW ABRE; etiolation; erd; XX OS Arabidopsis thaliana XX RA Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, RA Yamaguchi-Shinozaki K. RT Two different novel cis-acting elements of erd1, a clpA RT homologous Arabidopsis gene function in induction by dehydration RT stress and dark-induced senescence. RL Plant J. 33: 259-270 (2003) RD PubMed: 12535340; XX RA Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, RA Shinozaki K, Yamaguchi-Shinozaki K. RT Transcriptional regulation of ABI3- and ABA-responsive genes RT including RD29B and RD29A in seeds, germinating embryos, and RT seedlings of Arabidopsis. RL Plant Mol Biol. 60:51-68 (2006). RD PubMed: 16463099 XX SQ ACGTG // ID ABREMOTIFAOSOSEM XX AC S000299 XX DT 16-Feb-2001 (last modified) seki XX DE "motif A" ABRE-like sequence found in rice (O.s.) Osem gene DE promoter; Essential for activation by VP1; Important for DE regulation by ABA; See S000102, S000300; TRAB1, bZIP DE transcription factor, interacts with VP1 and mediates abscisic DE acid-induced transcritption; XX KW ABRE; Em; Osem; ABA; VP1; seed; XX OS rice (Oryza sativa) XX RA Hattori T, Terada t, Hamasuna S RT Regulation of the Osem gene by abscisic acid and the RT transcriptional activator VP1: analysis of cis-acting promoter RT elements required for regulation by abscisic acid and VP1 RL Plant J 7: 913-925 (1995) RD PubMed: 7599651; GenBank: U22102 XX RA Hobo T, Kowyama Y, Hattori T RT A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic RT acid-induced transcription RL Proc Natl Acad Sci USA 96: 15348-15353 (1999) RD PubMed: 10611387; XX SQ TACGTGTC // ID ABREMOTIFIIIOSRAB16B XX AC S000291 XX DT 10-Feb-2000 (last modified) seki XX DE "Motif III" found in the promoter of rice (O.s.) rab16B gene; DE Motif I (S000290) and motif III are both required for ABA DE responsiveness; However, each can substitute for the other; XX KW ABA; ABRE; motif III; rab16B; XX OS rice (Oryza sativa) XX RA Ono A, Izawa T, Chua N-H, Shimamoto K RT The rab16B promoter of rice contains two distinct abscisic RT acid-responsive elements RL Plant Physiol 112: 483-491 (1996) RD PubMed: 8883374 XX SQ GCCGCGTGGC // ID ABREMOTIFIOSRAB16B XX AC S000290 XX DT 10-Feb-2000 (last modified) seki XX DE "Motif I" found in the promoter of rice (O.s.) rab16B gene; Motif DE I and motif III (S000291) are both required for ABA DE responsiveness; However, each can substitute for the other; See DE S000019, S000120; XX KW ABA; ABRE; motif I; rab16B; XX OS rice (Oryza sativa) XX RA Ono A, Izawa T, Chua N-H, Shimamoto K RT The rab16B promoter of rice contains two distinct abscisic RT acid-responsive elements RL Plant Physiol 112: 483-491 (1996) RD PubMed: 8883374 XX SQ AGTACGTGGC // ID ABREOSRAB21 XX AC S000012 XX DT 10-Feb-2000 (last modified) seki XX DE "ABA responsive element (ABRE)" of wheat Em and rice (O.s.) rab21 DE genes; Proposed consensus sequence for the repeated motif (Em1a DE and Em1b) of wheat Em gene; S=C/G; XX KW ABA; ABRE; Em; rab; Em1a; Em1b; seed; XX OS rice (Oryza sativa); wheat (Triticum aestivum) XX RA Marcotte WR Jr, Russell SH, Quatrano RS RT Abscisic acid-responsive sequences from the Em gene of wheat. RL Plant Cell 1:969-976 (1989) RD PubMed: 2562556; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC review RD PubMed: 9617810; XX RA Skriver K, Mundy J RT Gene expression in response to abscisic acid and osmotic stress RL Plant Cell 2: 503-512 (1990) RC review RD PubMed: 2152172 XX SQ ACGTSSSC // ID ABRERATCAL XX AC S000507 XX DT 04-January-2007 (last modified) kehi XX DE "ABRE-related sequence" or "Repeated sequence motifs" identified DE in the upstream regions of 162 Ca(2+)-responsive upregulated DE genes; see also ABRE; M=C/A; Y=T/C; B=T/C/G; XX KW ABRE; calcium; XX OS Arabidopsis thaliana XX RA Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm RA H. RT Rapid Transcriptome Changes Induced by Cytosolic Ca2+ Transients RT Reveal ABRE-Related Sequences as Ca2+-Responsive cis Elements in RT Arabidopsis. RL Plant Cell. 18:2733-2748 (2006) RD PubMed: 16980540 XX SQ MACGYGB // ID ABRETAEM XX AC S000015 XX DT 29-Sep-1999 (last modified) kehi XX DE "ABRE (ABA responsive element)" found in wheat (T.a.) Em gene; DE transacting factor: EMBP-1; EMBP-1 binds to CACGTGGC; See S000119 DE EMBP1; XX KW ABA; ABRE; EMBP-1; seed; XX OS wheat (Triticum aestivum) XX RA Guiltinan MJ, Marcotte WR Jr, Quatrano RS RT A plant leucine zipper protein that recognizes an abscisic acid RT response element RL Science 250:267-270 (1990) RD PubMed: 2145628; GenBank: M62893, M63999; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810 XX SQ GGACACGTGGC // ID ABREZMRAB28 XX AC S000133 XX DT 23-June-2006 (last modified) kehi XX DE ABRE; ABA and water-stress responses; Found in maize (Z.m.) DE rab28; maize rab28 is ABA-inducible in embryos and vegetative DE tissues; Found in the Arabidopsis (A.t.) alcohol dehydrogenase DE (Adh) gene promoter; "ABRE2"; Found in the maize (Z.m.) Cat1 gene DE promoter; Responsible for the induction by ABA; Binding site of DE CBF2; Arabidopsis CBF1 overexpression induces COR genes and DE enhances freezing tolerance; The CBF genes do not appear to be DE autoregulated through the CRT/DRE sequence; XX KW ABRE; rab28; G-box; Adh; Cat1; ABA; CBF1; DRE; RGA1; COR; KW freezing tolerance; seed; shoot; CBF2; XX OS maize (Zea mays); Arabidopsis thaliana; rice (Oryza sativa); OS Populus spp.; XX RA Suzuki M, Ketterling MG, McCarty DR. RT Quantitative statistical analysis of cis-regulatory sequences in RT ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis. RL Plant Physiol.139: 437-447 (2005) RC in silico RD PubMed: 16113229 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Alonso-Blanco C, Gomez-Mena C, Llorente F, Koornneef M, Salinas RA J, Martinez-Zapater JM RT Genetic and Molecular Analyses of Natural Variation Indicate CBF2 RT as a Candidate Gene for Underlying a Freezing Tolerance RT Quantitative Trait Locus in Arabidopsis RL Plant Physiology 139: 1304-1312 (2005) RD PubMed: 16244146 XX RA Guan LM, Zhao J, Scandalios JG RT Cis-elements and trans-factors that regulate expression of the RT maize Cat1 antioxidant gene in response to ABA and osmotic RT stress: H2O2 is the likely intermediary signaling molecule for RT the response RL Plant J 22: 87-95 (2000) RD PubMed: 10792824; XX RA Benedict C, Skinner JS, Meng R, Chang Y, Bhalerao R, Huner NPA, RA Finn CE, Chen THH, Hurry V RT The CBF1-dependent low temperature signalling pathway, regulon RT and increase in freeze tolerance are conserved in Populus spp. RL Plant, Cell and Environment 29:1259-1272 (2006) XX RA Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, RA Thomashow MF RT Arabidopsis CBF1 overexpression induces COR genes and enhances RT freezing tolerance RL Science 1998 3: 104-106 (1998) RD PubMed: 9525853; XX RA Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, RA Thomashow MF RT Low temperature regulation of the Arabidopsis CBF family of AP2 RT transcriptional activators as an early step in cold-induced COR RT gene expression RL Plant J 16: 433-442 (1998) RD PubMed: 9881163; XX SQ CCACGTGG // ID ACEATCHS XX AC S000355 XX DT 02-August-2006 (last modified) kehi XX DE "ACEAtCHS (ACGT containing element)" found in the LRU DE (light-responsive unit) in Arabidopsis (A.t.) chalcone synthase DE (CHS) gene promoter; Required for UV-B and UV-1/blue light DE responsiveness; See S000356; Transcriptional repression by AtMYB4 DE controls production of UV-protecting sun screens in Arabidopsis; DE AtMYB4 mutant shows enhanced levels of sinapate ester in leaves DE and tolerance of UV-B irradiation; AtMYB4 expression is DE downregulated by exposure to UV-B light; XX KW CHS; ACE; MYB; light; UV-A; UV-B; MYB4; leaf; shoot; XX OS Arabidopsis thaliana XX RA Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, RA Weisshaar B RT Identification of UV/blue light-response elements in the RT Arabidopsis thaliana chalcone synthase promoter using a RT homologous protoplast transient expression system RL Plant Mol Biol (1998) 36: 741-754 RD PubMed: 9526507; XX RA Jin H, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, RA Tonelli C, Weisshaar B, Martin C RT Transcriptional repression by AtMYB4 controls production of RT UV-protecting sunscreens in Arabidopsis RL EMBO J 19: 6150-6161 (2000) RD PubMed: 11080161; XX RA Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B. RT Differential combinatorial interactions of cis-acting elements RT recognized by R2R3-MYB, BZIP, and BHLH factors control RT light-responsive and tissue-specific activation of RT phenylpropanoid biosynthesis genes. RL Plant Mol Biol. 57: 155-171 (2005). RD PubMed: 15821875 XX SQ GACACGTAGA // ID ACGTABOX XX AC S000130 XX DT 7-Sep-2000 (last modified) seki XX DE "A-box" according to the nomenclature of ACGT elements by Foster DE et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; Found in DE ocs gene; RITA-1 binding site (Izawa et al. 1994); "G motif" by DE Toyofuku et al. (1998); G motif and TATCCAY motif (a GATA motif DE as its antisense sequence; see S000256) are responsible for DE sugar repression (Toyofuku et al. 1998); See S000346; XX KW A-box; ACGT element; G motif; sugar; repression; seed; XX OS plant; rice (Oryza sativa); XX RA Foster R, Izawa T, Chua N-H RT Plant bZIP Proteins gather at ACGT elements. RL FASEB J 8:192-200 (1994) RC Review RD PubMed: 8119490; XX RA Izawa T, Foster R, Nakajima M, Shimamoto K, Chua N-H RT The rice bZIP transcriptional activator RITA-1 is highly RT expressed during seed development. RL Plant Cell 6:1277-1287 (1994) RD PubMed: 7919992; GenBank: L34551; XX RA Toyofuku K, Umemura T, Yamaguchi J RT Promoter elements required for sugar-repression of the RAmy3D RT gene for alpha-amylase in rice RL FEBS Lett 428:275-280 (1998) RD PubMed: 9654148 XX SQ TACGTA // ID ACGTABREMOTIFA2OSEM XX AC S000394 XX DT 06-January-2006 (last modified) kehi XX DE Experimentally determined sequence requirement of ACGT-core of DE motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE DE are interdependent in the ABA-responsive expression of the rd29A DE in Arabidopsis; K=G/T; XX KW ABA; ABRE; motif A; DRE; XX OS rice (Oryza sativa); Arabidopsis thaliana; XX RA Hattori T, Totsuka M, Hobo T, Kagaya Y, Yamamoto-Toyoda A RT Experimentally Determined Sequence Requirement of ACGT-Containing RT Abscisic Acid Response Element RL Plant Cell Physiol 43: 136-140 (2002) RD PubMed: 11828032; XX RA Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe RA H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K. RT Interaction between two cis-acting elements, ABRE and DRE, in RT ABA-dependent expression of Arabidopsis rd29A gene in response to RT dehydration and high-salinity stresses. RL Plant J. 34: 137-148 (2003) RD PubMed: 12694590; XX SQ ACGTGKC // ID ACGTABREMOTIFAOSOSEM XX AC S000281 XX DT 16-Feb-2001 (last modified) seki XX DE "ABRE motif A" found in the promoter of the rice (O.s.) Osem DE gene; ACGT-containing ABRE; Required for ABA-responsiveness and DE VP1 activation; Binding site of TRAB1; Motif A and CE3 (S000282) DE are functionally equivalent; TRAB1, bZIP transcription factor, DE interacts with VP1 and mediates abscisic acid-induced DE transcritption; XX KW Motif A; ABRE; CE3; ABA; VP1; TRAB1; Osem; Em; bZIP; seed; XX OS rice (Oryza sativa) XX RA Hobo T, Asada M, Kowyama Y, Hattori T RT ACGT-containing abscisic acid response element (ABRE) and RT coupling element 3 (CE3) are functionally equivalent RL Plant J 19: 679-689 (1999) RD PubMed: 10571853; XX RA Hobo T, Kowyama Y, Hattori T RT A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic RT acid-induced transcription RL Proc Natl Acad Sci USA 96: 15348-15353 (1999) RD PubMed: 10611387; XX SQ TACGTGTC // ID ACGTATERD1 XX AC S000415 XX DT 03-Jun-2003 (last modified) kehi XX DE ACGT sequence (from -155 to -152) required for etiolation-induced DE expression of erd1 (early responsive to dehydration) in DE Arabidopsis; XX KW ACGT; etiolation; erd; XX OS Arabidopsis thaliana XX RA Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, RA Yamaguchi-Shinozaki K. RT Two different novel cis-acting elements of erd1, a clpA RT homologous Arabidopsis gene function in induction by dehydration RT stress and dark-induced senescence. RL Plant J. 33: 259-270 (2003) RD PubMed: 12535340; XX SQ ACGT // ID ACGTCBOX XX AC S000131 XX DT 16-Jan-1998 (last modified) kehi XX DE "C-box" according to the nomenclature of ACGT elements by Foster DE et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; Factors DE groups 1, 2 and 3 have affinity for C-box (Izawa et al. J Mol DE Biol. 230:1131-1144 (1993)); RITA-1 binding site (Izawa et al. DE 1994); XX KW C-box; ACGT element; seed; XX OS plant; XX RA Foster R, Izawa T, Chua N-H RT Plant bZIP Proteins gather at ACGT elements. RL FASEB J 8:192-200 (1994) RC Review RD PubMed: 8119490; XX RA Izawa T, Foster R, Nakajima M, Shimamoto K, Chua N-H RT The rice bZIP transcriptional activator RITA-1 is highly RT expressed during seed development. RL Plant Cell 6:1277-1287 (1994) RD PubMed: 7919992; GenBank: L345501; XX RA Izawa T, Foster R, Chua N-H RT Plant bZIP protein DNA binding specificity. RL J Mol Biol 230:1131-1144 (1993) RD PubMed: 8487298; XX SQ GACGTC // ID ACGTOSGLUB1 XX AC S000278 XX DT 16-Feb-2001 (last modified) seki XX DE "ACGT motif" found in GluB-1 gene in rice (O.s.); Required for DE endosperm-specific expression; Conserved in the 5'-flanking DE region of glutelin genes; See S000276, S000277; See DE S000019;Combination of GCN4, AACA and ACGT motifs was found DE sufficient to confer a detectable level of endosperm expression; DE See S000353, S000354; XX KW GluB-1; glutelin; endosperm; seed; storage protein; ACGT motif; XX OS rice (Oryza sativa) XX RA Washida H, Wu CY, Suzuki A, Yamanouchi U, Akihama T, Harada K, RA Takaiwa F RT Identification of cis-regulatory elements required for endosperm RT expression of the rice storage protein glutelin gene GluB-1 RL Plant Mol Biol 40:1-12 (1999) RD PubMed: 10394940; XX RA Wu C, Washida H, Onodera Y, Harada K, Takaiwa F RT Quantitative nature of the Prolamin-box, ACGT and AACA motifs in RT a rice glutelin gene promoter: minimal cis-element requirements RT for endosperm-specific gene expression RL Plant J 23: 415-421 (2000) RD PubMed: 10929134; XX SQ GTACGTG // ID ACGTROOT1 XX AC S000016 XX DT 31-Jul-2001 (last modified) uchi XX DE "ACGT motif" related to root expression; Gene: synthetic; perfect DE palindromic sequence (PA) containing G-box-related sequence; DE transacting factor: TAF-1 ?; Binding of SGBF-1 (a Soybean G-box DE binding bZIP transcription factor) to ABRE is enhanced by SCOF-1 DE (a zinc finger protein ); Transcription of SCOF-1 is induced by DE low temperature and ABA; XX KW root; ACGT; G box; G-box; ABRE motif; bZIP binding enhancement; KW cold tolerance; COR; SGBF-1; SCOF-1; XX OS tobacco (Nicotiana tabacum); soybean (Glycine max) XX RA Salinas J, Oeda K, Chua N-H RT Two G-box-related sequences confer different expression patterns RT in transgenic tobacco RL Plant Cell 4:1485-1493 (1992) RD PubMed: 1467649; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Kim JC, Lee SH, Cheong YH, Yoo CM, Lee SI, Chun HJ, Yun DJ, Hong RA JC, Lee SY, Lim CO, Cho MJ RT A novel cold-inducible zinc finger protein from soybean, SCOF-1, RT enhances cold tolerance in transgenic plants RL Plant J 25: 247-259 (2001) RD PubMed: 11208017; XX SQ GCCACGTGGC // ID ACGTSEED2 XX AC S000018 XX DT 17-May-1998 (last modified) kehi XX DE "ACGT motif" related to seed expression; Gene: French bean DE phaseolin; transacting factor: 02; XX KW phaseolin; seed; ACGT; XX OS French bean; bean (Phaseolus vulgaris) XX RA Bustos M RL personal communication (cited in a review by Thomas TL, 1993) XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX SQ ACACACGTCAA // ID ACGTSEED3 XX AC S000019 XX DT 10-Feb-2000 (last modified) seki XX DE "ACGT motif" related to seed expression; Gene: synthetic; DE wild-type motif (Iwt) containing G-box-related sequence; DE transacting factor: bZIP ?; A tobacco bZip transcription DE activator (TAF-1) binding site; XX KW seed; ACGT; G-box; G box; XX OS tobacco XX RA Salinas J, Oeda K, Chua N-H RT Two G-box-related sequences confer different expression patterns RT in transgenic tobacco. RL Plant Cell 4:1485-1493 (1992) RD PubMed: 1467649; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Oeda K, Salinas J, Chua N-H RT A tobacco bZip transcription activator (TAF-1) binds to a RT G-box-like motif conserved in plant genes RL EMBO J 10: 1792-1802 (1991) RD PubMed: 2050116 XX SQ GTACGTGGCG // ID ACGTTBOX XX AC S000132 XX DT 18-Mar-1998 (last modified) kehi XX DE "T-box" according to the nomenclature of ACGT elements by Foster DE et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; See also DE ACGTABOX (S000130), ACGTCBOX (S000131), and CACGTGMOTIF DE (S000042); XX KW T-box; T box; ACGT element: XX OS plant; XX RA Foster R, Izawa T, Chua N-H RT Plant bZIP Proteins gather at ACGT elements. RL FASEB J 8:192-200 (1994) RC Review RD PubMed: 8119490; XX SQ AACGTT // ID ACIIIPVPAL2 XX AC S000194 XX DT 15-September-2006 (last modified) kehi XX DE ACIII element found at -246 to -238 of bean (P.v.) PAL2 promoter; DE ACIII element is required for vascular-specific gene expression; DE See also ACIPVPAL2 (S000192) and ACIIPVPAL2 (S000193); Three DE AC-elements, which are possible Myb protein binding sites, DE together with a G-box, interact to direct the complex patterns of DE tissu-specific expression of pAL2 gene; Implicated in the DE xylem-localized regulation of genes encoding lignin biosynthetic DE enzymes in loblolly pine (Patzlaff et al., 2003); XX KW vascular; PAL; PAL2; ACIII; phloem; xylem; stem; lignin; MYB; KW R2R3-MYB; XX OS bean (Phaseolus vulgaris); Pinus taeda (loblolly pine); XX RA Hatton D, Sablowski R, Yung MH, Smith C, Schuch W, Bevan M RT Tow classes of cis sequences contribute to tissue-specific RT expression of a PAL2 promoter in transgenic tobacco RL Plant J 7:859-876 (1995) RD PubMed: 7599647; XX RA Patzlaff A, Newman LJ, Dubos C, Whetten RW, Smith C, McInnis S, RA Bevan MW, Sederoff RR, Campbell MM RT Characterisation of Pt MYB1, an R2R3-MYB from pine xylem. RL Plant Mol Biol. 53:597-608 (2003). RD PubMed: 15010621 XX RA Gomez-Maldonado J, Avila C, Torre F, Canas R, Canovas FM, RA Campbell MM RT Functional interactions between a glutamine synthetase promoter RT and MYB proteins. RL Plant J. 39:513-526 (2004). RD PubMed: 15272871 XX SQ GTTAGGTTC // ID ACIIPVPAL2 XX AC S000193 XX DT 15-September-2006 (last modified) kehi XX DE ACII element found at -131 to -120 of bean (P.v.) PAL2 promoter; DE ACII element is required for vascular-specific gene expression; DE See also ACIPVPAL2 (S000192) and ACIIIPVPAL2 (S000194); Three DE AC-elements, which are possible Myb protein binding sites, DE together with a G-box, interact to direct the complex patterns of DE tissu-specific expression of pAL2 gene; Implicated in the DE xylem-localized regulation of genes encoding lignin biosynthetic DE enzymes in loblolly pine (Patzlaff et al., 2003); XX KW vascular; PAL; ACII; phloem; xylem; stem; lignin; MYB; R2R3-MYB; XX OS bean (Phaseolus vulgaris); Pinus taeda (loblolly pine); XX RA Hatton D, Sablowski R, Yung MH, Smith C, Schuch W, Bevan M RT Tow classes of cis sequences contribute to tissue-specific RT expression of a PAL2 promoter in transgenic tobacco RL Plant J 7:859-876 (1995) RD PubMed: 7599647; XX RA Patzlaff A, Newman LJ, Dubos C, Whetten RW, Smith C, McInnis S, RA Bevan MW, Sederoff RR, Campbell MM RT Characterisation of Pt MYB1, an R2R3-MYB from pine xylem. RL Plant Mol Biol. 53:597-608 (2003). RD PubMed: 15010621 XX RA Gomez-Maldonado J, Avila C, Torre F, Canas R, Canovas FM, RA Campbell MM RT Functional interactions between a glutamine synthetase promoter RT and MYB proteins. RL Plant J. 39:513-526 (2004). RD PubMed: 15272871 XX SQ CCACCAACCCCC // ID ACIPVPAL2 XX AC S000192 XX DT 15-September-2006 (last modified) kehi XX DE ACI element found at -83 to -74 of bean (P.v.) PAL2 promoter; DE AC-rich element; ACI element is required for vascular-specific DE gene expression; See also ACIIPVPAL2 (S000193) and ACIIIPVPAL2 DE (S000194); Three AC-elements, which are possible Myb protein DE binding sites, together with a G-box, interact to direct the DE complex patterns of tissue-specific expression of pAL2 gene; DE Implicated in the xylem-localized regulation of genes encoding DE lignin biosynthetic enzymes in loblolly pine (Patzlaff et al., DE 2003); XX KW vascular; PAL; ACI; phloem; xylem; stem; lignin; MYB; R2R3-MYB; XX OS Phaseolus vulgaris(bean); Pinus taeda (loblolly pine); XX RA Hatton D, Sablowski R, Yung MH, Smith C, Schuch W, Bevan M RT Tow classes of cis sequences contribute to tissue-specific RT expression of a PAL2 promoter in transgenic tobacco RL Plant J 7:859-876 (1995) RD PubMed: 7599647; XX RA Patzlaff A, Newman LJ, Dubos C, Whetten RW, Smith C, McInnis S, RA Bevan MW, Sederoff RR, Campbell MM RT Characterisation of Pt MYB1, an R2R3-MYB from pine xylem. RL Plant Mol Biol. 53:597-608 (2003). RD PubMed: 15010621 XX RA Gomez-Maldonado J, Avila C, Torre F, Canas R, Canovas FM, RA Campbell MM RT Functional interactions between a glutamine synthetase promoter RT and MYB proteins. RL Plant J. 39:513-526 (2004). RD PubMed: 15272871 XX SQ CCCACCTACC // ID AGAMOUSATCONSENSUS XX AC S000342 XX DT 16-May-2001 (last modified) uchi XX DE Binding consensus sequence of Arabidopsis (A.t.) AGAMOUS MADS DE domain; MCM1 binding-sites in a-mating-type-specific promoters of DE Saccharomyces cerevisiae show similarities with the binding-site DE sequence of the AGAMOUS MADS domain; See S000316; MADS domain and DE I region of AGAMOUS are sufficient and necessary for DNA binding; DE Both the K domain and C region are indispensable for AG function DE in flower development; See S000338; XX KW AGAMOUS; MADS domain; flower; XX OS Arabidopsis thaliana XX RA Shiraishi H, Okada K, Shimura Y RT Nucleotide sequences recognized by the AGAMOUS MADS domain of RT Arabidopsis thaliana in vitro RL Plant J 4: 385-398 (1993) RD PubMed: 8106084; XX RA Mizukami Y, Huang H, Tudor M, Hu Y, Ma H RT Functional domains of the floral regulator AGAMOUS: RT characterization of the DNA binding domain and analysis of RT dominant negative mutations RL Plant Cell 8:831-845 (1996) RD PubMed: 8672883; XX SQ TTDCCWWWWWWGGHAA // ID AGATCONSENSUS XX AC S000316 XX DT 16-May-2001 (last modified) uchi XX DE Binding consensus sequence for the product of the Arabidopsis DE (A.t.) floral homeotic gene AGAMOUS (AG); AG protein contains a DE region similar to the DNA binding domain of SRF and MCM1; The DE consensus sequence contains a CArG box; AG protein is a putative DE transcription factor for floral genes; H=A/T/C; W=A/T; See DE S000342; MADS domain and I region of AGAMOUS are sufficient and DE necessary for DNA binding; Both the K domain and C region are DE indispensable for AG function in flower development; See DE S000338; XX KW floral homeotic gene; AGAMOUS; AG; MCM1; SRF; GArG box; APETALA2; KW flower; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Huang H, Mizukami Y, Hu Y, Ma H RT Isolation and characterization of the binding sequences for the RT product of the Arabidopsis floral homeotic gene AGAMOUS RL Nucleic Acids Res. 21: 4769-4776 (1993) RD PubMed: 7901838; XX RA Mizukami Y, Huang H, Tudor M, Hu Y, Ma H RT Functional domains of the floral regulator AGAMOUS: RT characterization of the DNA binding domain and analysis of RT dominant negative mutations RL Plant Cell 8:831-845 (1996) RD PubMed: 8672883; XX RA Drews GN, Bowman JL, Meyerowitz EM RT Negative regulation of the Arabidopsis homeotic gene AGAMOUS by RT the APETALA2 product RL Cell 65 :991-1002 (1991) RD PubMed: 1675158; XX SQ TTWCCWWWWNNGGWW // ID AGCBOXNPGLB XX AC S000232 XX DT 02-August-2006 (last modified) kehi XX DE "AGC box" repeated twice in a 61 bp enhancer element in tobacco DE (N.p.) class I beta-1,3-glucanase (GLB) gene; See S000036, DE S000089; "GCC-box"; Binding sequence of Arabidopsis AtERFs; DE AtERF1,2 and 5 functioned as activators of GCC box-dependent DE transcription; AtERF3 and 4 acted as repressors; AtERF proteins DE are stress signal-response factors; EREBP2 binding site; DE Conserved in most PR-protein genes; Rice MAPK (BWMK1) DE phosphorylates OS EREBP1, which enhance DNA-binding activity of DE the factor to the GCC box; XX KW AGC box; GLB; ERE; ERFs; Ethylene; GCC-box; Neutral PR-5; KW osmotin-like protein; EREBP2; MAPK; BWMK1; PR box; XX OS tobacco (Nicotiana plumbaginifolia); Arabidopsis (Arabidopsis OS thaliana); tobacco (Nicotiana sylvestris); Oryza sativa; rice; XX RA Hart CM, Nagy F, Meins Jr F RT A 61 bp enhancer element of the tobacco beta-1,3-glucanase B gene RT interacts with one or more regulated nuclear proteins RL Plant Mol Biol 21:121-131 (1993) RD PubMed: 8425042; XX RA Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M RT Arabidopsis ethylene-responsive element binding factors act as RT transcriptional activators or repressors of GCC box-mediated gene RT expression RL Plant Cell 12:393-404 (2000) RD PubMed: 10715325; XX RA Sato F, Kitajima S, Koyama T, Yamada Y RT Ethylene-induced gene expression of osmotin-like protein, a RT neutral isoform of tobacco PR-5, is mediated by the AGCCGCC RT cis-sequence RL Plant Cell Physiol 37: 249-255 (1996) RD PubMed: 8673338; XX RA Ohme-Takagi M, Suzuki K, Shinshi H RT Regulation of Ethylene-Induced Transcription of Defense Genes RL Plant Cell Physiol 41: 1187-1192 (2000) RD PubMed: 11092902; XX RA Rushton PJ, Reinstadler A, Lipka V, Lippok B, Somssich IE RT Synthetic plant promoters containing defined regulatory elements RT provide novel insights into pathogen- and wound-induced RT signaling RL Plant Cell 14: 749-762 (2002) RD PubMed: 11971132; XX RA Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim RA JC, Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ RT BWMK1, a rice mitogen-activated protein kinase, locates in the RT nucleus and mediates pathogenesis-related gene expression by RT activation of a transcription factor. RL Palnt Physiol. 132: 1961-1972 (2003) RD PubMed: 12913152; XX RA Zhang H, Huang Z, Xie B, Chen Q, Tian X, Zhang X, Zhang H, Lu X, RA Huang D, Huang R. RT The ethylene-, jasmonate-, abscisic acid- and NaCl-responsive RT tomato transcription factor JERF1 modulates expression of GCC RT box-containing genes and salt tolerance in tobacco. RL Planta. 220: 262-270 (2004) RD PubMed: 15300440 XX SQ AGCCGCC // ID AGL1ATCONSENSUS XX AC S000338 XX DT 16-May-2001 (last modified) uchi XX DE Binding consensus sequence of Arabidopsis (A.t.) AGL1 DE (AGAMOUS-like 1); AGL1 contains MADS domain; See S000339; AGL20 DE is a MADS domain gene from Arabidopsis that is activated in shoot DE apical meristem during the transition to flowering; AGL20 is also DE regulated by the Gibberellin pathway; Complex regulatory net DE works involving several MADS-genes underlie development of DE vegetative structures; XX KW MADS; AGL1; AGAMOUS; AGL20; floral induction; photoperiod; KW endosperm; gurd cells; root; trichome; leaf; shoot; flower; XX OS Arabidopsis thaliana XX RA Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H RT DNA binding properties of two Arabidopsis MADS domain proteins: RT binding consensus and dimer formation RL Plant Cell 8: 81-94 (1996) RD PubMed: 8597661; XX RA Borner R, Kampmann G, Chandler J, Gleissner R, Wisman E, Apel K, RA Melzer S RT A MADS domain gene involved in the transition to flowering in RT Arabidopsis RL Plant J 24: 591-599 (2000) RD PubMed: 11123798; XX RA Alvarez-Buylla ER, Liljegren SJ, Pelaz S, Gold SE, Burgeff C, RA Ditta GS, Vergara-Silva F, Yanofsky MF RT MADS-box gene evolution beyond flowers: expression in pollen, RT endosperm, guard cells, roots and trichomes RL Plant J 24: 457-466 (2000) RD PubMed: 11115127 XX SQ NTTDCCWWWWNNGGWAAN // ID AGL2ATCONSENSUS XX AC S000339 XX DT 16-May-2001 (last modified) uchi XX DE Binding consensus sequence of Arabidopsis (A.t.) AGL2 DE (AGAMOUS-like 2); AGL2 contains MADS domain; AGL2 binds DNA as a DE dimer; See S000338; XX KW MADS; AGL1; AGAMOUS; flower; XX OS Arabidopsis thaliana XX RA Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H RT DNA binding properties of two Arabidopsis MADS domain proteins: RT binding consensus and dimer formation RL Plant Cell 8: 81-94 (1996) RD PubMed: 8597661; XX SQ NNWNCCAWWWWTRGWWAN // ID AGL3ATCONSENSUS XX AC S000343 XX DT 7-Sep-2000 (last modified) seki XX DE Binding consensus sequence of Arabidopsis(A.t.) AGL3; AGL3 is DE MADS-box domain protein; AGL3 is expressed in all above-ground DE vegetative organs; AGL3 may be involved the transcriptional DE regulation of genes; XX KW MADS-box; AGL3; CArG; stem; leaf; flower; shoot; XX OS Arabidopsis thaliana XX RA Huang H, Tudor M, Weiss CA, Hu Y, Ma H RT The Arabidopsis MADS-box gene AGL3 is widely expressed and RT encodes a sequence-specific DNA-binding protein RL Plant Mol Biol 28:549-567 (1995) RD PubMed: 7632923; GenBank: U81368; U81369; U81370; XX SQ TTWCYAWWWWTRGWAA // ID AGMOTIFNTMYB2 XX AC S000444 XX DT 28-Jan-2004 (last modified) kehi XX DE AG-motif found at -114 of the promoter of NtMyb2 gene; NtMyb2 is DE a regulator of the tobacco retrotransposon Tto1 and the DE defence-related gene phenylalanine ammonia lyase (PAL), which are DE induced by various stress such as wounding or elicitor treatment; DE AGP1 (GATA-type zinc finger protein) binding site; XX KW MYB; Tto1; PAL; AGP1; GATA; XX OS Nicotiana tabacum (tobacco) XX RA Sugimoto K, Takeda S, Hirochika H RT Transcriptional activation mediated by binding of a plant RT GATA-type zinc finger proteinAGP1 to the AG-motif (AGATCCAA) of RT the wound-inducible Myb gene NtMyb2. RL Plant J, 36: 550-564 (2003) RD PubMed: 14617085; XX SQ AGATCCAA // ID AGTACSAO XX AC S000258 XX DT 14-Oct-1999 (last modified) kehi XX DE "AGTA repeat" in pumpkin (C.s.) ascorbate oxidase gene (AO) DE promoter; Found in silencer region; AOBP (AGTA repeat binding DE protein) binding site; AOBP protein has DOF domain; Required for DE repression of expression of AO gene; XX KW AGTA repeat; DOF; AOBP; ascorbate oxidase; silencer region; XX OS pumpkin (Cucurbita sp.) XX RA Kisu Y, Ono T, Shimofurutani N, Suzuki M, Esaka M RT Characterization and expression of a new class of zinc finger RT protein that binds to silencer region of ascorbate oxidase gene RL Plant Cell Physiol 39:1054-1064 (1998) RD PubMed: 9871365; GenBank: D45066; XX SQ AAAAAGTAAAAAGTAAAAAAGTAAAAAG // ID ALF1NTPARC XX AC S000238 XX DT 11-Oct-1999 (last modified) kehi XX DE "ALF-1 (as-1-like sequence binding factor)" binding site found in DE tobacco (N.t.) parC gene; Found in auxin-responsive regions; DE as-1-like sequences in parA, parB and parC bind with ASF-1, DE ALF-2, and ALF-1, respectively; See S000190 (ABFOS); XX KW as-1; ALF-1; par; auxin; XX OS tobacco (Nicotiana tabacum); XX RA Sakai T, Takahashi Y, Nagata T RT The identification of DNA binding factor specific for as-1-like RT sequences in auxin-responsive regions of parA, parB and parC RL Plant Cell Physiol 39:731-739 (1998) RD PubMed: 9729895; XX SQ TTACGCAAGCAATGACA // ID ALF2NTPARB XX AC S000239 XX DT 11-Oct-1999 (last modified) kehi XX DE "ALF-2 (as-1-like sequence binding factor 2)" binding site found DE in tobacco (N.t.) parB gene; Found in auxin-responsive regions; DE as-1-like sequences in parA, parB and parC bind with ASF-1, DE ALF-2, and ALF-1, respectively; See S000190 (ABFOS); XX KW as-1; ALF-2; par; auxin; XX OS tobacco (Nicotiana tabacum); XX RA Sakai T, Takahashi Y, Nagata T RT The identification of DNA binding factor specific for as-1-like RT sequences in auxin-responsive regions of parA, parB and parC RL Plant Cell Physiol 39:731-739 (1998) RD PubMed: 9729895; XX SQ TGAGGAGACTTGTGAGGT // ID AMMORESIIUDCRNIA1 XX AC S000374 XX DT 31-Jul-2001 (last modified) uchi XX DE Motifs (IIU and IID) found in the Chlamydomonas (C.R.) Nia1 gene DE promoter; Involved in ammonium-response; Located between -231 and DE -219 and also between -76 and -65; Involved in Nia1 transcription DE activation; W=T/A; XX KW nitrate reductase; ammonium response; XX OS Chlamydomonas reinhardtii XX RA Loppes R, Radoux M RT Identification of short promoter regions involved in the RT transcriptional expression of the nitrate reductase gene in RT Chlamydomonas reinhardtii RL Plant Mol Biol 45: 215-227 (2001) RD PubMed: 11289512; XX SQ GGWAGGGT // ID AMMORESIVDCRNIA1 XX AC S000375 XX DT 31-Jul-2001 (last modified) uchi XX DE Motif (IVD) found in the Chlamydomonas (C.R.) Nia1 gene promoter; DE Located between -51 and -42; Involved in Nia1 transcription DE repression; XX KW nitrate reductase; ammonium response; XX OS Chlamydomonas reinhardtii XX RA Loppes R, Radoux M RT Identification of short promoter regions involved in the RT transcriptional expression of the nitrate reductase gene in RT Chlamydomonas reinhardtii RL Plant Mol Biol 45: 215-227 (2001) RD PubMed: 11289512; XX SQ CGAACTT // ID AMMORESVDCRNIA1 XX AC S000376 XX DT 31-Jul-2001 (last modified) uchi XX DE Motif (VD) found in the Chlamydomonas (C.R.) Nia1 gene promoter; DE Located between -33 and -8; Involved in Nia1 transcription DE activation; XX KW nitrate reductase; ammonium response; XX OS Chlamydomonas reinhardtii XX RA Loppes R, Radoux M RT Identification of short promoter regions involved in the RT transcriptional expression of the nitrate reductase gene in RT Chlamydomonas reinhardtii RL Plant Mol Biol 45: 215-227 (2001) RD PubMed: 11289512; XX SQ GGCCCCGGG // ID AMYBOX1 XX AC S000020 XX DT 17-May-1998 (last modified) kehi XX DE "amylase box"; Conserved sequence found in 5'-upstream region of DE alpha-amylase gene of rice, wheat, barley; XX KW amylase; seed; XX OS barley (Hordeum vulgare); rice (Oryza sativa); wheat (Triticum OS aestivum) XX RA Huang N, Sutliff TD, Litts JC, Rodriguez RL RT Classification and characterization of the rice alpha-amylase RT multigene family. RL Plant Mol Biol 14:655-668 (1990) RD PubMed: 2102847; GenBank: X16509; XX SQ TAACARA // ID AMYBOX2 XX AC S000021 XX DT 17-May-1998 (last modified) kehi XX DE "amylase box"; "amylase element"; Conserved sequence found in DE 5'upstream region of alpha-amylase gene of rice, wheat, barley; DE "amylase box" (Huang et al. 1990); "amylase element" (Hwang et DE al., 1998); XX KW amylase; seed; XX OS barley (Hordeum vulgare); rice (Oryza sativa); wheat (Triticum OS aestivum) XX RA Huang N, Sutliff TD, Litts JC, Rodriguez RL RT Classification and characterization of the rice alpha-amylase RT multigene family. RL Plant Mol Biol 14:655-668 (1990) RD PubMed: 2102847; GenBank: X16509; XX RA Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL RT Three cis-elements required for rice alpha-amylase Amy3D RT expression during sugar starvation RL Plant Mol Biol 36:331-341 (1998) RD PubMed: 9484474; XX SQ TATCCAT // ID ANAERO1CONSENSUS XX AC S000477 XX DT 05-November-2005 (last modified) kehi XX DE One of 16 motifs found in silico in promoters of 13 anaerobic DE genes involved in the fermentative pathway (anaerobic set DE 1)(Mohanty et al., 2005); Arbitrary named ANAERO1CONSENSUS by the DE PLACEdb curator; See also S000478, S000479, S000480, S000481; XX KW anaerobic; XX OS Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); OS Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida OS (petunia); Lycopersicon esculentum (tomato); XX RA Mohanty B, Krishnan SP, Swarup S, Bajic VB. RT Detection and preliminary analysis of motifs in promoters of RT anaerobically induced genes of different plant species. RL Ann Bot (Lond).96: 669-681 (2005) RC in silico RD PubMed: 16027132 XX SQ AAACAAA // ID ANAERO2CONSENSUS XX AC S000478 XX DT 05-November-2005 (last modified) kehi XX DE One of 16 motifs found in silico in promoters of 13 anaerobic DE genes involved in the fermentative pathway (anaerobic set DE 1)(Mohanty et al., 2005); Arbitrary named ANAERO2CONSENSUS by the DE PLACEdb curator; See also S000477, S000479, S000480, S000481; XX KW anaerobic; XX OS Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); OS Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida OS (petunia); Lycopersicon esculentum (tomato); XX RA Mohanty B, Krishnan SP, Swarup S, Bajic VB. RT Detection and preliminary analysis of motifs in promoters of RT anaerobically induced genes of different plant species. RL Ann Bot (Lond).96: 669-681 (2005) RC in silico RD PubMed: 16027132 XX SQ AGCAGC // ID ANAERO3CONSENSUS XX AC S000479 XX DT 05-November-2005 (last modified) kehi XX DE One of 16 motifs found in silico in promoters of 13 anaerobic DE genes involved in the fermentative pathway (anaerobic set DE 1)(Mohanty et al., 2005); Arbitrary named ANAERO3CONSENSUS by the DE PLACEdb curator; See also S000477, S000478, S000480, S000481; XX KW anaerobic; XX OS Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); OS Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida OS (petunia); Lycopersicon esculentum (tomato); XX RA Mohanty B, Krishnan SP, Swarup S, Bajic VB. RT Detection and preliminary analysis of motifs in promoters of RT anaerobically induced genes of different plant species. RL Ann Bot (Lond).96: 669-681 (2005) RC in silico RD PubMed: 16027132 XX SQ TCATCAC // ID ANAERO4CONSENSUS XX AC S000480 XX DT 05-November-2005 (last modified) kehi XX DE One of 16 motifs found in silico in promoters of 13 anaerobic DE genes involved in the fermentative pathway (anaerobic set DE 1)(Mohanty et al., 2005); Arbitrary named ANAERO4CONSENSUS by the DE PLACEdb curator; See also S000477, S000478, S000479, S000481; DE H=A/T/C; XX KW anaerobic; XX OS Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); OS Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida OS (petunia); Lycopersicon esculentum (tomato); XX RA Mohanty B, Krishnan SP, Swarup S, Bajic VB. RT Detection and preliminary analysis of motifs in promoters of RT anaerobically induced genes of different plant species. RL Ann Bot (Lond).96: 669-681 (2005) RC in silico RD PubMed: 16027132 XX SQ GTTTHGCAA // ID ANAERO5CONSENSUS XX AC S000481 XX DT 05-November-2005 (last modified) kehi XX DE One of 16 motifs found in silico in promoters of 13 anaerobic DE genes involved in the fermentative pathway (anaerobic set DE 1)(Mohanty et al., 2005); Arbitrary named ANAERO5CONSENSUS by the DE PLACEdb curator; See also S000477, S000478, S000479, S000480; XX KW anaerobic; XX OS Zea mays (maize); Arabidopsis thaliana; Pisum sativum (pea); OS Hordeum vulgare (barley); Oryza sativa (rice); Petunia hybrida OS (petunia); Lycopersicon esculentum (tomato); XX RA Mohanty B, Krishnan SP, Swarup S, Bajic VB. RT Detection and preliminary analysis of motifs in promoters of RT anaerobically induced genes of different plant species. RL Ann Bot (Lond).96: 669-681 (2005) RC in silico RD PubMed: 16027132 XX SQ TTCCCTGTT // ID ANAEROBICCISZMGAPC4 XX AC S000350 XX DT 16-Feb-2001 (last modified) seki XX DE 20 bp anaerobic cis-regulatory sequence found in the maize (Z.m.) DE GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; DE Located between -286 and -266; Required for anaerobic gene DE expression in transgenic tobacco; See S000351; XX KW anaerobic; GapC4; Glyceraldehyde-3-phosphate dehydrogenase; XX OS maize (Zea mays) XX RA Geffers R, Cerff R, Hehl R RT Anaerobiosis-specific interaction of tobacco nuclear factors with RT cis-regulatory sequences in the maize GapC4 promoter RL Plant Mol Biol 43: 11-21 (2000) RD PubMed: 10949370; XX SQ CGAAACCAGCAACGGTCCAG // ID ARE1 XX AC S000022 XX DT 16-Jan-1998 (last modified) kehi XX DE "ARE (antioxidant response element)"; antioxidant response DE element of rat glutathione S-transferase Ya subunit, and rat DE NAD(P)H:quinone reductase genes; XX KW antioxidant response element; ARE; oxidative stress; active KW oxygen; XX OS rat XX RA Rushmore TH, Morton MR, Pickett CB RT The antioxidant responsive element. Activation by oxidative RT stress and identification of the DNA consensus sequence required RT for functional activity. RL J Biol Chem 266:11632-11639 (1991) RD PubMed: 1646813; XX SQ RGTGACNNNGC // ID ARECOREZMGAPC4 XX AC S000393 XX DT 21-May-2002 (last modified) uchi XX DE Putative binding site for a Myb found in the promoter of maize DE glycolytic glyceraldehyde-3-phospate dehydrogenase 4 (GapC4) DE gene; Essential for anaerobic induction; XX KW anaerobic; GapC4; Myb protein; XX OS maize (Zea mays) XX RA Geffers R, Sell S, Cerff R, Hehl R RT The TATA box and a Myb binding site are essential for anaerobic RT expression of a maize GapC4 minimal promoter in tobacco RL Biochim Biophys Acta 1521: 120-125 (2001) RD PubMed: 11690643; XX SQ AGCAACGGTC // ID ARELIKEGHPGDFR2 XX AC S000437 XX DT 28-November-2004 (last modified) kehi XX DE Sequence highly similar to ARE (anthocyanin regulatory element) DE found in maize anthocyanin promoter (Tuerck and Fromm 1994; DE Lesnick and Chandler 1998); Binding site of R2R3-type MYB factor, DE GMYB 10 of G. hybrida; XX KW anthocyanina; ARE; DRF; C1; R2R3; MYB; a2; XX OS Gerbera hybrida (Astraceae); Zea mays (maize) XX RA Elomaa P, Uimari A, Mehto M, Albert VA, Latinen RAE, Teeri TH. RT Activation of anthocyanin biosynthesis in Gerbera hybrida RT (Asteraceae) suggests conserved protein-protein and RT protein-promoter interactions between the anciently diverged RT monocots and eudicots. RL Plant Physiol. 133: 1831-1842 (2003) RD PubMed: 14605235; XX RA Hernandez JM, Heine GF, Irani NG, Feller A, Kim MG, Matulnik T, RA Chandler VL, Grotewold E. RT Different mechanisms participate in the R-dependent activity of RT the R2R3 MYB transcription factor C1. RL J Biol Chem. 279: 48205-48213 (2004). RD PubMed: 15347654 XX RA Lesnick ML, Chandler VL. RT Activation of the maize anthocyanin gene a2 is mediated by an RT element conserved in many anthocyanin promoters. RL Plant Physiol. 117: 437-445 (1998). RD PubMed: 9625696 XX SQ AGTTGAATGGGGGTGCA // ID ARFAT XX AC S000270 XX DT 01-August-2006 (last modified) kehi XX DE ARF (auxin response factor) binding site found in the promoters DE of primary/early auxin response genes of Arabidopsis thaliana DE (A.t.); AuxRE; See S000337; Binding site of Arabidopsis ARF1 DE (Auxin response factor1); Sequence found in NDE element in DE Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter; See DE S000359, S000360; Found in D1 or D4 element in Soybean (G.m.) GH3 DE promoter; This element was enriched in the 5'-flanking region of DE genes up-regulated by both IAA and BL (Goda et al., 2004); XX KW auxin; AuxRE; ARF; ARF1; Aux/IAA; SAUR; NDE; GH3; D1; D4; XX OS Arabidopsis thaliana; Soybean (Glycine max); Oryza sativa (rice) XX RA Ulmasov T, Hagen G, Guilfoyle TJ RT Dimerization and DNA binding of auxin response factors RL Plant J 19:309-319 (1999) RD PubMed: 10476078; XX RA Nag R, Maity MK, Dasgupta M. RT Dual DNA binding property of ABA insensitive 3 like factors RT targeted to promoters responsive to ABA and auxin. RL Plant Mol Biol. 59: 821-838 (2005). RD PubMed: 16270233 XX RA Inukai Y, Sakamoto T, Ueguchi-Tanaka M, Shibata Y, Gomi K, RA Umemura I, Hasegawa Y, Ashikari M, Kitano H, Matsuoka M. RT Crown rootless1, Which Is Essential for Crown Root Formation in RT Rice, Is a Target of an AUXIN RESPONSE FACTOR in Auxin RT Signaling. RL Plant Cell 17: 1387-1396 (2005) RD PubMed: 15829602 XX RA Harper RM, Stowe-Evans EL, Luesse DR, Muto H, Tatematsu K, RA Watahiki MK, Yamamoto K, Liscum E RT The NPH4 locus encodes the auxin response factor ARF7, a RT conditional regulator of differential growth in aerial RT Arabidopsis tissue RL Plant Cell 12: 757-770 (2000) RD PubMed: 10810148; XX RA Nemhauser JL, Mockler TC, Chory J. RT Interdependency of brassinosteroid and auxin signaling in RT Arabidopsis. RL PLoS Biol. 2(9):E258. (2004) RD PubMed: 15328536 XX RA Goda H, Sawa S, Asami T, Fujioka S, Shimada Y, Yoshida S. RT Comprehensive comparison of auxin-regulated and RT brassinosteroid-regulated genes in Arabidopsis. RL Plant Physiol. 134: 1555-1573 (2004). RD PubMed: 15047898 XX RA Hagen G, Guilfoyle T RT Auxin-responsive gene expression: genes, promoters and regulatory RT factors RL Plant Mol Biol. 49 :373-385 (2002) RC Review RD PubMed: 12036261; XX SQ TGTCTC // ID ARR1AT XX AC S000454 XX DT 27-March-2004 (last modified) kehi XX DE "ARR1-binding element" found in Arabidopsis; ARR1 is a response DE regulator; N=G/A/C/T; AGATT is found in the promoter of rice DE non-symbiotic haemoglobin-2 (NSHB) gene (Ross et al., 2004); XX KW ARR1; Response regulator; XX OS Arabidopsis thaliana XX RA Sakai H, Aoyama T, Oka A. RT Arabidopsis ARR1 and ARR2 response regulators operate as RT transcriptional activators. RL Plant J. 24: 703-711 (2000). RD PubMed: 11135105 XX RA Ross EJ, Stone JM, Elowsky CG, Arredondo-Peter R, Klucas RV, RA Sarath G. RT Activation of the Oryza sativa non-symbiotic haemoglobin-2 RT promoter by the cytokinin-regulated transcription factor, ARR1. RL J Exp Bot. 55: 1721-1731 (2004). RD PubMed: 15258171 XX SQ NGATT // ID AS1CAMV XX AC S000023 XX DT 16-Jan-1998 (last modified) kehi XX DE "as-1 (activation sequence 1)" in CaMV 35S promoter; from -85 to DE -58 (subdomain AI); Binding with ASF-1 (activation sequence DE factor 1) from pea and tobacco; Expression in root and leaf; XX KW CaMV 35S promoter; ASF-1; leaf; root; as-1; XX OS Cauliflower mosaic virus; CaMV; XX RA Lam E, Benfey PN, Gilmartin PM, Fang R-X, Chua N-H RT Site-specific mutations alter in vitro factor binding and change RT promoter expression pattern in transgenic plants. RL Proc Natl Acad Sci USA 86:7890-7894 (1989) RD PubMed: 2813365; XX RA Benfey PN, Chua NH RT The cauliflower mosaic virus 35S promoter: combinatorial RT regulation of transcription in plants RL Science 250:959-966 (1990) XX SQ CCACTGACGTAAGGGATGACGCACAATCC // ID AS1LIKECSHPRA XX AC S000260 XX DT 14-Oct-1999 (last modified) kehi XX DE as-1-like motif found in cucumber (C.s.) hydroxypyruvate DE reductase (hprA) gene; Required for cytokinin responsiveness; DE Also see S000261 (CYTOSITECSHPRA); XX KW cytokinin; as-1; as-1 TGACG motif; XX OS cucumber (Cucumis sativus) XX RA Jin G, Davey MC, Ertl JR, Chen R, Yu Z, Daniel SG, Becker WM, RA Chen C RT Interaction of DNA-binding proteins with the 5'-flanking region RT of a cytokinin-responsive cucumber hydroxypyruvate reductase RT gene RL Plant Mol Biol 38:713-724 (1998) RD PubMed: 9862489; XX SQ AAATGACGAAAATGC // ID ASF1ATNOS XX AC S000073 XX DT 7-Sep-2000 (last modified) seki XX DE Tobacco ASF-1 binding site in nopaline synthase (NOS) promoter of DE Ti-plasmid of Agrobacterium tumefaciens (A.t.); From -131 to DE -111; See S000312; Containing two hexamer motifs; Essential for DE the nos promoter activity; XX KW nopaline synthase; ASF-1; auxin; methyl jasmonate; salicylic KW acid; XX OS Agrobacterium tumefaciens XX RA Lam E, Katagiri F, Chua NH RT Plant nuclear factor ASF-1 binds to an essential region of the RT nopaline synthase promoter. RL J Biol Chem 265:9909-9913 (1990) RD PubMed: 2351681; XX RA Kim Y, Buckley K, Costa MA, An G RT A 20 nucleotide upstream element is essential for the nopaline RT synthase (nos) promoter activity RL Plant Mol Biol 24: 105-117 (1994) RD PubMed: 8111010; XX SQ TGAGCTAAGCACATACGTCAG // ID ASF1MOTIFCAMV XX AC S000024 XX DT 11-May-2006 (last modified) kehi XX DE "ASF-1 binding site" in CaMV 35S promoter; ASF-1 binds to two DE TGACG motifs; See S000023 (AS1); Found in HBP-1 binding site of DE wheat histone H3 gene; TGACG motifs are found in many promoters DE and are involved in transcriptional activation of several genes DE by auxin and/or salicylic acid; May be relevant to light DE regulation; Binding site of tobacco TGA1a; TGA1a and b show DE homology to CREB; TGA6 is a new member of the TGA family; Abiotic DE and biotic stress differentially stimulate "as-1 element" DE activity; XX KW TGACG; root; leaf; CaMV; 35S; promoter; auxin; salicylic acid; KW light; as-1; TGA1a, TGA1b; CREB; ASF1; TGA6; shoot; xenobiotic KW stress; SAR; SA; Disease resistance; XX OS CaMV; Cauliflower mosaic virus; plant; tobacco (Nicotiana OS tabacum); Arabidopsis thaliana; XX RA Despres C, Chubak C, Rochon A, Clark R, Bethune T, Desveaux D, RA Fobert PR. RT The Arabidopsis NPR1 disease resistance protein is a novel RT cofactor that confers redox regulation of DNA binding activity to RT the basic domain/leucine zipper transcription factor TGA1. RL Plant Cell 15: 2181-2191 (2003) RD PubMed: 12953119; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) XX RA Benfey PN, Chua NH RT The cauliflower mosaic virus 35S promoter: combinatorial RT regulation of transcription in plants RL Science 250:959-966 (1990) XX RA Katagiri F, Lam E, Chua NH RT Two tobacco DNA-binding proteins with homology to the nuclear RT factor CREB RL Nature 31: 727-730 (1989) RD PubMed: 2528073; XX RA Xiang C, Miao Z, Lam E RT DNA-binding properties, genomic organization and expression RT pattern of TGA6,a new member of the TGA family of bZIP RT transcription factors in Arabidopsis thaliana RL Plant Mol Biol 34: 403-415 (1997) RD PubMed: 9225852 XX RA Klinedinst S, Pascuzzi P, Redman J, Desai M, Arias J RT A xenobiotic-stress-activated transcription factor and its RT cognate target genes are preferentially expressed in root tip RT meristems RL Plant Mol Biol 42: 679-688 (2000) RD PubMed: 10809441; XX RA Redman J, Whitcraft J, Johnson C, Arias J RT Abiotic and biotic stress differentially stimulate as-1 element RT activity in Arabidopsis RL Plant Cell Rep. 21: 180-185 (2002) XX SQ TGACG // ID ASF1NTPARA XX AC S000240 XX DT 11-Oct-1999 (last modified) kehi XX DE "ASF-1 (as-1 binding nuclear factor)" binding site found in DE tobacco (N.t.) parA gene; Found in auxin-responsive regions; DE as-1-like sequences in parA, parB and parC bind with ASF-1, DE ALF-2, and ALF-1, respectively; See S000190 (ABFOS), S000238 DE (ALF1NTPARC), S000239 (ALF2NTPARB); XX KW as-1; ASF-1; par; auxin; XX OS tobacco (Nicotiana tabacum); XX RA Sakai T, Takahashi Y, Nagata T RT The identification of DNA binding factor specific for as-1-like RT sequences in auxin-responsive regions of parA, parB and parC RL Plant Cell Physiol 39:731-739 (1998) RD PubMed: 9729895; XX SQ TTACGCAAGCAATGACAT // ID AT1BOX XX AC S000025 XX DT 17-May-1998 (last modified) kehi; XX DE "AT-1 box (AT-rich element)" found in the promoter region of the DE genes for tobacco ( N.p.) chlorophyll a/b binding protein (cab) DE and small subunit of ribulose-1,5-bisphosphate carboxylase DE (rbcS); Deletion of a region containing the AT-1 site in the DE tomato RBCS3A gene strongly inhibited reporter gene expression, DE whereas AT-1 site in N. plumbaginifolia CAB gene (cab-E) is in a DE negative element (Terzaghi & Cashmore, 1995); XX KW AT-1; cab; rbcS; photoregulated genes; light-regulated genes; KW light; leaf; shoot; XX OS pea (Pisum sativum); tobacco (Nicotiana plumbaginifolia); tomato OS (Lycopersicon esculentum); XX RA Datta N, Cashmore AR RT Binding of a pea nuclear protein to promoters of certain RT photoregulated genes is modulated by phosphorylation. RL Plant Cell 1:1069-1077 (1989) RD PubMed: 2562560; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR RT Both positive and negative regulatory elements mediate expression RT of a photoregulated CAB gene from Nicotiana plumbaginifolia. RL EMBO J 7:1929-1936 (1988) RD PubMed: 2901343; GenBank: X12512; XX RA Ueda T, Pichersky E, Malik VS, Cashmore AR RT The level of expression of the tomato rbcs-3A gene is modulated RT by a far-upstream promoter element in a developmentary regulated RT manner. RL Plant Cell 1:217-227 (1989) RD PubMed: 2535544; GenBank: S44160; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ AATATTTTTATT // ID ATHB1ATCONSENSUS XX AC S000317 XX DT 7-Sep-2000 (last modified) seki XX DE Recognition sequence of Arabidopsis Athb-1 protein; Athb-1 DE protein has a HD-Zip motif (homeodomain (HD) with a closely DE linked leucine zipper motif (Zip)); HD-Zip domain binds to DNA as DE a dimer; See S000318; W=A/T; XX KW Athb-1; homeodomain; Zip; HD-Zip motif; XX OS Arabidopsis thaliana XX RA Sessa G, Morelli G, Ruberti I RT The Athb-1 and -2 HD-Zip domains homodimerize forming complexes RT of different DNA binding specificities RL EMBO J 12:3507-3517 (1993) RD PubMed: 8253077; XX SQ CAATWATTG // ID ATHB2ATCONSENSUS XX AC S000318 XX DT 7-Sep-2000 (last modified) seki XX DE Recognition sequence of Arabidopsis Athb-2 protein; Athb-2 DE protein has a HD-Zip motif (homeodomain (HD) with a closely DE linked leucine zipper motif (Zip)); See S000317; S=C/G; XX KW Athb-2; homeodomain; Zip; HD-Zip motif; XX OS Arabidopsis thaliana XX RA Sessa G, Morelli G, Ruberti I RT The Athb-1 and -2 HD-Zip domains homodimerize forming complexes RT of different DNA binding specificities RL EMBO J 12:3507-3517 (1993) RD PubMed: 8253077; XX SQ CAATSATTG // ID ATHB5ATCORE XX AC S000371 XX DT 05-November-2005 (last modified) kehi XX DE Consensus binding sequence for Arabidopsis (A.T.) class I HDzip DE (Homeodomein-leucine zipper) protein, ATHB5; ATHB5 protein forms DE dimers in solution; ATHB5 and ATHB6 exhibit identical DNA binding DE specificities; ATHB5 forms heterodimers with other class I HDzip DE proteins; See also S000475; XX KW Homeodomein-leucine zipper; HDzip; ATHB5; class I; HDZip I; XX OS Arabidopsis thaliana XX RA Johannesson H, Wang Y, Engstrom P RT DNA-binding and dimerization preferences of Arabidopsis RT homeodomain-leucine zipper transcription factors in vitro RL Plant Mol Biol 45: 63-73 (2001) RD PubMed: 11247607; XX RA Henriksson E, Olsson AS, Johannesson H, Johansson H, Hanson J, RA Engstrom P, Soderman E. RT Homeodomain leucine zipper class I genes in Arabidopsis. RT Expression patterns and phylogenetic relationships. RL Plant Physiol. 139: 509-518. (2005) RD PubMed: 16055682 XX SQ CAATNATTG // ID ATHB6COREAT XX AC S000399 XX DT 27-Aug-2002 (last modified) uchi XX DE Consensus binding sequence for Arabidopsis (A.T.) DE homeodomain-leucine zipper protein, ATHB6; ATHB6 is a target of DE the protein phosphatase ABI1 and regulates hormone responses; See DE S000371; XX KW ATHB6; ABA; ABI1; homeodomain-leucine zipper; XX OS Arabidopsis thaliana XX RA Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E RT Homeodomain protein ATHB6 is a target of the protein phosphatase RT ABI1 and regulates hormone responses in Arabidopsis RL EMBO J. 21:3029-3038 (2002) RD PubMed: 12065416; XX SQ CAATTATTA // ID ATRICHPSPETE XX AC S000248 XX DT 11-Oct-1999 (last modified) kehi XX DE A/T-rich sequences found in pea (P.s.) plastocyanin gene (petE) DE promoter; Act as quantitative enhancer; Found at -289 to -255 of DE pea PetE gene; XX KW A/T-rich; AT-rich; AT rich; enhancer; XX OS pea (Pisum sativum) XX RA Sandhu JS, Webster CI, Gray JC RT A/T-rich sequences act as quantitative enhancers of gene RT expression in transgenic tobacco and potato plants RL Plant Mol Biol 37:885-896 (1998) RD PubMed: 9678583; XX SQ AATATACTAGTATTATTTACTAAAAAAAATC // ID AUXREPSIAA4 XX AC S000026 XX DT 16-Feb-2001 (last modified) seki XX DE "AuxRE (Auxine responsive element )" of pea (P.s.) PS-IAA4/5 DE gene; Indoleacetic acid-inducible genes; domain A; TGA1a is DE preferentially expressed in root tip meristems; TGA1a may DE contribute to the expression of GST isoenzymes, especially in DE root tip meristems; XX KW Auxin; AuxRE; root; meristem; XX OS pea (Pisum sativum) XX RA Ballas N, Wong LM, Theologis A RT Identification of the auxin-responsive element, AuxRE, in the RT primary indoleacetic acid-inducible gene, PS-IAA4/5, of pea RT (Pisum sativum). RL J Mol Biol 233:580-596 (1993) RD PubMed: 8411166; GenBank: X68216; XX RA Guilfoyle T, Hagen G, Ulmasov T, Murfett J RT How does auxin turn on genes? RL Plant Physiol 118: 341-347 (1998) RC Review RD PubMed: 9765520; XX RA Klinedinst S, Pascuzzi P, Redman J, Desai M, Arias J RT A xenobiotic-stress-activated transcription factor and its RT cognate target genes are preferentially expressed in root tip RT meristems RL Plant Mol Biol 42: 679-688 (2000) RD PubMed: 10809441; XX SQ KGTCCCAT // ID AUXRETGA1GMGH3 XX AC S000234 XX DT 7-Sep-2000 (last modified) seki XX DE "TGA-box #1" in putative auxin-resonsive element (AUXRE) of DE soybean (G.m.) GH3 promoter; Strong binding site for proteins in DE plant nuclear extracts; XX KW TGA; AUXRE; auxin; GH3; XX OS soybean (Glycine max) XX RA Liu ZB, Ulmasov T, Shi X, Hagen G, Guilfoyle TJ RT Soybean GH3 promoter contains multiple auxin-inducible elements RL Plant Cell 6:645-657 (1994) RD PubMed: 8038604; XX RA Liu ZB, Hagen G, Guilfoyle TJ RT A G-box-binding protein from soybean binds to the E1 RT auxin-response element in the Soybean GH3 promoter and contains a RT proline-rich repression domain RL Plant Physiol 115:397-407 (1997) RD PubMed: 9342862; XX RA Guilfoyle T, Hagen G, Ulmasov T, Murfett J RT How does auxin turn on genes? RL Plant Physiol 118: 341-347 (1998) RC Review RD PubMed: 9765520; XX SQ TGACGTAA // ID AUXRETGA2GMGH3 XX AC S000235 XX DT 7-Sep-2000 (last modified) seki XX DE "TGA-box #2" in putative auxin-resonsive element (AUXRE) E1 of DE soybean (G.m.) GH3 promoter; Strong binding site for proteins in DE plant nuclear extracts; Hex-like element; E1 element=-249 to DE -203; E2 element=-241 to -224; Called G-box by Liu et al. DE (1997); XX KW TGA; AUXRE; auxin; GH3; E1; G-box; XX OS soybean (Glycine max) XX RA Liu ZB, Ulmasov T, Shi X, Hagen G, Guilfoyle TJ RT Soybean GH3 promoter contains multiple auxin-inducible elements RL Plant Cell 6:645-657 (1994) RD PubMed: 8038604; XX RA Liu ZB, Hagen G, Guilfoyle TJ RT A G-box-binding protein from soybean binds to the E1 RT auxin-response element in the Soybean GH3 promoter and contains a RT proline-rich repression domain RL Plant Physiol 115:397-407 (1997) RD PubMed: 9342862; XX RA Guilfoyle T, Hagen G, Ulmasov T, Murfett J RT How does auxin turn on genes? RL Plant Physiol 118: 341-347 (1998) RC Review RD PubMed: 9765520; XX SQ TGACGTGGC // ID B2GMAUX28 XX AC S000325 XX DT 7-Sep-2000 (last modified) seki XX DE "B2"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; Located between -310 and DE -301; Contains a TGACGACA sequence which is similar to TGACGT/C DE sequence found in Ocs, CaMV35S and histone H3 promoter; Contains DE as-1 motif; XX KW auxin; Aux28; as-1; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ CTTGTCGTCA // ID BBOXSITE1STPAT XX AC S000398 XX DT 27-Aug-2002 (last modified) uchi XX DE "10 base pair motif (site 1)" within the B-box found in the DE potato patatin gene promoter; Involved in potato tuber-specific DE and sucrose-inducible gene expression; Storekeeper (STK) binds to DE this region and regulates patatin expression in potato; XX KW STK (Storekeeper); tuber; patatin; B-box; XX OS Solanum tuberosum (potato) XX RA Zourelidou M, de Torres-Zabala M, Smith C, Bevan MW RT Storekeeper defines a new class of plant-specific DNA-binding RT proteins and is a putative regulator of patatin expression RL Plant J. 30 :489-497 (2002) RD PubMed: 12028578; XX SQ GCTAAACAAT // ID BIHD1OS XX AC S000498 XX DT 02-August-2006 (last modified) kehi XX DE Binding site of OsBIHD1, a rice BELL homeodomain transcription DE factor; XX KW HD; homeodomain; XX OS Oryza sativa (rice) XX RA Luo H, Song F, Goodman RM, Zheng Z. RT Up-regulation of OsBIHD1, a rice gene encoding BELL homeodomain RT transcriptional factor, in disease resistance responses. RL Plant Biol (Stuttg). 7: 459-468 (2005). RC Electrophoretic mobility shift assays with recombinant OsBIHD1 RC protein; RD PubMed: 16163610 XX SQ TGTCA // ID BOX1PSGS2 XX AC S000222 XX DT 19-August-2004 (last modified) kehi XX DE Box 1 element in pea (P.s.) glutamine synthetase (GS2) gene; An DE element in a 33-bp AT-rich sequence (box 1) of the 5' end of a DE GS2 promoter; Located at -837 to -827 of pea GS2; Multimer of box DE 1 element was used to isolate a cDNA encoding an AT-rich DNA DE binding protein (ATBP-1) (Tjaden & Coruzzi, 1994); XX KW Box 1; glutamine synthetase; GS2; ATBp; ATBP-1; XX OS pea (Pisum sativum) XX RA Tjaden G, Coruzzi GM RT A novel AT-rich DNA binding protein that combines an HMG I-like RT DNA binding domain with a putative transcription domain RL Plant Cell 6:107-118 (1994) RD PubMed: 7907505; XX RA Tjaden G, Edwards JW, Coruzzi GM RT cis elements and trans-acting factors affecting regulation of a RT nonphotosynthetic light-regulated gene for chloroplast glutamine RT synthetase RL Plant Physiol 108:1109-1117 (1995) RD PubMed: 7630938; GenBank: U22971; XX SQ ATAGAAATCAA // ID BOX1PVCHS15 XX AC S000208 XX DT 11-May-2006 (last modified) kehi XX DE Box 1 of bean (P.v.) chs15 promoter; one of SBF-1 binding sites DE in chs15 promoter; Located at -318 to -305; Involved in DE organ-specific expression in plant development; Functions as a DE transcriptional silencer in electroporated protoplasts derived DE from undifferentiated suspension-cultured soybean cells; Resemble DE the binding site for the GT-1 factor in light-responsive DE elements; For a compilation of related GT elements and factors, DE see Villain et al. (1996); XX KW Box 1; chs; chs15; CHS; SBF-1; silencer; organ-specific; Gt; KW GT-1; GT; XX OS bean (Phaseolus vulgaris) XX RA Lawton MA, Dean SM, Dron M, Kooter JM, Kragh KM, Harrison MJ, Yu RA L, Tanguay L, Dixon RA, Lamb CJ RT Silencer region of a chalcone synthase promoter contains multiple RT binding sites for a factor, SBF-1, closely related to GT-1 RL Plant Mol Biol 16:235-249 (1991) RD PubMed: 1893099; GenBank: X59469; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ TAAAAGTTAAAAAC // ID BOX2PSGS2 XX AC S000204 XX DT 17-May-1998 (last modified) kehi XX DE Box 2 in glutamine synthetase (GS2) gene in pea (P.s.); Repeated DE in tandem with a partial palindrome located between the repeats; DE Located at ca. -300 of pea GS2; XX KW Box 2; glutamine synthetase; GS2; XX OS pea (Pisum sativum); XX RA Tjaden G, Edwards JW, Coruzzi GM RT cis elements and trans-acting factors affecting regulation of a RT nonphotosynthetic light-regulated gene for chloroplast glutamine RT synthetase RL Plant Physiol 108:1109-1117 (1995) RD PubMed: 7630938; GenBank: U22971; XX SQ TCTAAGCAAAG // ID BOX2PVCHS15 XX AC S000209 XX DT 11-May-2006 (last modified) kehi XX DE Box 2 of bean (P.v.) chs15 promoter; SBF-1 binding site; For a DE compilation of related GT elements and factors, see Villain et DE al. (1996); XX KW Box 2; chs; chs15; CHS; SBF-1; GT-1; GT; XX OS bean (Phaseolus vulgaris) XX RA Lawton MA, Dean SM, Dron M, Kooter JM, Kragh KM, Harrison MJ, Yu RA L, Tanguay L, Dixon RA, Lamb C RT Silencer region of a chalcone synthase promoter contains multiple RT binding sites for a factor, SBF-1, closely related to GT-1 RL Plant Mol Biol 16:235-249 (1991) RD PubMed: 1893099; GenBank: X59469; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ CTGTGATTAAATAT // ID BOX3PVCHS15 XX AC S000210 XX DT 11-May-2006 (last modified) kehi XX DE Box 3 of bean (P.v.) chs15 promoter; SBF-1 binding site; For a DE compilation of related GT elements and factors, see Villain et DE al. (1996); XX KW Box 3; chs; chs15; CHS; SBF-1; GT-1; GT; XX OS bean (Phaseolus vulgaris) XX RA Lawton MA, Dean SM, Dron M, Kooter JM, Kragh KM, Harrison MJ, Yu RA L, Tanguay L, Dixon RA, Lamb CJ RT Silencer region of a chalcone synthase promoter contains multiple RT binding sites for a factor, SBF-1, closely related to GT-1 RL Plant Mol Biol 16:235-249 (1991) RD PubMed: 1893099; GenBank: X59469; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ TATTGGTTACTAAA // ID BOXBPSAS1 XX AC S000225 XX DT 17-May-1998 (last modified) kehi XX DE Box B in pea (P.s.) asparagine synthetase (AS1) gene; Found at DE -61; AS1 is negatively regulated by light; Box B binds with DE nuclear proteins; XX KW BOX B; AS; AS1; light; repression; negative regulation; XX OS pea (Pisum sativum) XX RA Ngai N, Tsai FY, Coruzzi G RT Light-induced transcriptional repression of the pea AS1 gene: RT identification of cis-elements and transfactors RL Plant J 12:1021-1234 (1997) RD PubMed: 9418044; XX SQ AAACGACACCGTTT // ID BOXC'PSAS1 XX AC S000227 XX DT 17-May-1998 (last modified) kehi XX DE Box C' in pea asparagine synthetase (AS1) gene; Found at -88; AS1 DE is negatively regulated by light; Box C' binds with nuclear DE proteins, which was competed by a putative repressor element RE1 DE (see S000195); XX KW BOX C'; AS; AS1; XX OS pea (Pisum sativum); XX RA Ngai N, Tsai FY, Coruzzi G RT Light-induced transcriptional repression of the pea AS1 gene: RT identification of cis-elements and transfactors RL Plant J 12:1021-1234 (1997) RD PubMed: 9418044; XX SQ TCCCGGTACACACTTCTT // ID BOXCPSAS1 XX AC S000226 XX DT 10-May-1998 (last modified) kehi XX DE Box C in pea (P.s.) asparagine synthetase (AS1) gene; Found at DE -45; AS1 is negatively regulated by light; Box C binds with DE nuclear proteins, which was competed by a putative repressor DE element RE1 (see S000195); XX KW BOX C; AS; AS1; XX OS pea (Pisum sativum) XX RA Ngai N, Tsai FY, Coruzzi G RT Light-induced transcriptional repression of the pea AS1 gene: RT identification of cis-elements and transfactors RL Plant J 12:1021-1234 (1997) RD PubMed: 9418044; XX SQ CTCCCAC // ID BOXICHS XX AC S000228 XX DT 16-May-1998 (last modified) kehi XX DE "Box I consensus sequence in the promoters of mustard and parsley DE chs genes; Essential for light regulation (Terzaghi & Cashmore, DE 1995); M=A/C; XX KW Box I; Box 1; Unit 1; CHS; chs; light regulation; XX OS parsley (Petroselinum crispum); mustard (Sinapis alba); XX RA Block A, Dangl JL, Hahlbrock K, Schulze-Lefert P RT Functional borders, genetic fine structure, and distance RT requirements of cis elements mediating light responsiveness of RT the parsley chalcone synthase promoter RL Proc Natl Acad Sci USA 87:5387-5391(1990) RD PubMed: 2371277 XX RA Rocholl M, Talke-Messerer C, Kaiser T, Batschauer A RT Unit 1 of the mustard chalcone synthase promoter is sufficient to RT mediate light responses from different photoreceptors. RL Plant Sci 97:189-198(1994) XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ GTCCMTCMAACCTAMC // ID BOXIINTPATPB XX AC S000296 XX DT 10-Feb-2000 (last modified) seki XX DE "Box II" found in the tobacco (N.t.) plastid atpB gene promoter; DE Conserved in several NCII (nonconsensus type II) promoters of DE plastid genes; Important for the activity of this NCII promoter; DE See S000295; XX KW plastid; NEP; atpB; PatpB; NCII; Box I; Box II; XX OS tobacco (Nicotiana tabacum) XX RA Kapoor S, Sugiura M RT Identification of two essential sequence elements in the RT nonconsensus type II PatpB-290 plastid promoter by using plastid RT transcription extracts from cultured tobacco BY-2 cells RL Plant Cell 11: 1799-1810 (1999) RD PubMed: 10488244 XX SQ ATAGAA // ID BOXIIPCCHS XX AC S000229 XX DT 01-August-2006 (last modified) kehi XX DE Core of "Box II/G box" found in the parsley (P.c.) chs genes; DE Essential for light regulation (Terzaghi & Cashmore, 1995); See DE S000345; XX KW Box II; Box 2; CHS; chs; light regulation; XX OS parsley (Petroselinum crispum) XX RA Block A, Dangl JL, Hahlbrock K, Schulze-Lefert P RT Functional borders, genetic fine structure, and distance RT requirements of cis elements mediating light responsiveness of RT the parsley chalcone synthase promoter RL Proc Natl Acad Sci USA 87:5387-5391(1990) RD PubMed: 2371277 XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX RA Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, RA Shinozaki K, Yamaguchi-Shinozaki K. RT Transcriptional regulation of ABI3- and ABA-responsive genes RT including RD29B and RD29A in seeds, germinating embryos, and RT seedlings of Arabidopsis. RL Plant Mol Biol. 60: 51-68 (2006) RD PubMed: 16463099 XX SQ ACGTGGC // ID BOXINTPATPB XX AC S000295 XX DT 10-Feb-2000 (last modified) seki XX DE "Box I" found in the tobacco (N.t.) plastid atpB gene promoter; DE Conserved in several NCII (nonconsensus type II) promoters of DE plastid genes; Important for the activity of this NCII promoter; DE See S000296; XX KW plastid; NEP; atpB; PatpB; NCII; Box I; Box II; XX OS tobacco (Nicotiana tabacum) XX RA Kapoor S, Sugiura M RT Identification of two essential sequence elements in the RT nonconsensus type II PatpB-290 plastid promoter by using plastid RT transcription extracts from cultured tobacco BY-2 cells RL Plant Cell 11: 1799-1810 (1999) RD PubMed: 10488244 XX SQ AATTCCATAGAATAGATAATA // ID BOXLCOREDCPAL XX AC S000492 XX DT 06-January-2006 (last modified) kehi XX DE Consensus of the putative "core" sequences of box-L-like DE sequences in carrot (D.c.) PAL1 promoter region; DCMYB1 bound to DE these sequences in vitro; See also S000136 (Box P), S000137 (Box DE A), S000138 (Box L); W=A/T; XX KW MYB; R2R3 type; PAL: Elicitor; UV-B; Dilution; XX OS Daucus carota (carrot) XX RA Maeda K, Kimura S, Demura T, Takeda J, Ozeki Y. RT DcMYB1 acts as a transcriptional activator of the carrot RT phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor RT treatment, UV-B irradiation and the dilution effect. RL Plant Mol Biol. 59: 739-752.(2005) RD PubMed: 16270227 XX SQ ACCWWCC // ID BP5OSWX XX AC S000436 XX DT 27-Jan-2004 (last modified) kehi XX DE OsBP-5 (a MYC protein) binding site in Wx promoter; XX KW MYC; Wx; Waxy; XX OS Oryza sativa (rice); XX RA Zhu Y, Cai X-L, Wang Z-Y, Hong M-M. RT An interaction between a MYC protein and an EREBP protein is RT involved in transcriptional regulation of the rice Wx gene. RL J. Biol. Chem. 278: 47803-47811 (2003) RD PubMed: 12947109; XX SQ CAACGTG // ID BS1EGCCR XX AC S000352 XX DT 16-Feb-2001 (last modified) seki XX DE "BS1 (binding site 1)" found in E. gunnii Cinnamoyl-CoA reductase DE (CCR) gene promoter; nuclear protein binding site; Required for DE vascular expression; XX KW cinnamoyl-CoA reductase; vascular; BS1; stem; XX OS Eucalyptus gunnii XX RA Lacombe E, Van Doorsselaere J, Boerjan W, Boudet AM, RA Grima-Pettenati J RT Characterization of cis-elements required for vascular expression RT of the cinnamoyl CoA reductase gene and for protein-DNA complex RT formation RL Plant J 23: 663-676 (2000) RD PubMed: 10972892; XX SQ AGCGGG // ID C1GMAUX28 XX AC S000326 XX DT 7-Sep-2000 (last modified) seki XX DE "C1"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; Located between -463 and DE -448; A/T-rich sequence; XX KW Auxin; Aux28; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ TGAAAACAGTGAGTTA // ID C1MOTIFZMBZ2 XX AC S000237 XX DT 23-Sep-1999 (last modified) kehi XX DE "C1-motif"; Similar to Myb-box; Found in the promoter region of DE maize (Z.m.) Bronze2 ( glutathione S-transferase) gene; C1 DE binding; C1-motif and R-motif were shown to be important for full DE R and C1 activation of the Bz2 promoter; S=C or G; XX KW C1-motif; Bronze2; Myb-box; glutathione S-transferase; C1; seed; XX OS maize (Zea mays) XX RA Bodeau JP, Walbot V RT Structure and regulation of the maize Bronze2 promoter RL Plant Mol Biol 32:599-609 (1996) RD PubMed: 8980512; XX SQ TAACTSAGTTA // ID C2GMAUX28 XX AC S000327 XX DT 7-Sep-2000 (last modified) seki XX DE "C2"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; Located between -552 and DE -553; Contains (ATT)4 sequence; XX KW Auxin; Aux28; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ AATAATAATAATAATAAATA // ID CAATBOX1 XX AC S000028 XX DT 17-May-1998 (last modified) kehi XX DE "CAAT promoter consensus sequence" found in legA gene of pea; XX KW CAAT; legA; seed; XX OS pea (Pisum sativum) XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX SQ CAAT // ID CAATBOX2 XX AC S000029 XX DT 5-Jun-1997 (last modified) kehi XX DE "CAAT box" found in the 5' upstream region (-80) of many DE eukaryotic genes; GGC(or T)CAATCT; XX KW eukaryotic gene; CAAT; XX OS eukaryote; XX SQ GGCCAATCT // ID CACGCAATGMGH3 XX AC S000368 XX DT 16-Feb-2001 (last modified) seki XX DE Sequence found in D4 element in Soybean (G.m.) GH3 gene promoter; DE Showed constitutive activity with TGTCTC element (See S000270); DE Confers auxin inducibility; Binding site of nuclear protein; See DE also S000369; XX KW D1; D4; GH3; Auxin; XX OS Soybean (Glycine max) XX RA Ulmasov T, Liu ZB, Hagen G, Guilfoyle TJ RT Composite structure of auxin response elements RL Plant Cell 7: 1611-1623 (1995) RD PubMed: 7580254; XX SQ CACGCAAT // ID CACGTGMOTIF XX AC S000042 XX DT 06-January-2006 (last modified) kehi XX DE "CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. DE roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as DE transcriptional repressors of the Str promoter via direct DE interaction with the G-box; See S000345; Essential for expression DE of beta-phaseolin gene during embryogenesis in bean, tobacco, DE Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene DE expression via GCC box and non-GCC box cis-element (Myb1 DE (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico DE analysis in both induced and repressed phyA-responsive promoters DE (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. DE "Light-regulated transcription" in Annu Rev Plant Physiol Plant DE Mol Biol 46:445-474 (1995); XX KW G box; G-box; rbcs; chs; ACGT element; adh; Bz-2; R-motif; STR; KW GT-1; GBF; elicitor; bZIP; napin; strictosidine synthase; cell; KW leaf; shoot; Pti4; ERF; PR; XX OS tomato (Lycopersicon esculentum); Arabidopsis thaliana; OS snapdragon (Antirrhinum majus); wheat (Triticum aestivum); OS parsley: maize (Zea mays); periwinkle (Catharanthus roseus); OS Brassica napus; bean (Phaseolus vulgaris); XX RA Chandrasekharan MB, Bishop KJ, Hall TC. RT Module-specific regulation of the beta-phaseolin promoter during RT embryogenesis. RL Plant J. 33: 853-866 (2003) RD PubMed: 12609027; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX RA Pasquali G, Erven ASW,Ouwerkerk PBF, Menke FLH, Memelink J RT The promoter of the strictosidine synthase gene from periwinkle RT confers elicitor-inducible expression in transgenic tobacco and RT binds nuclear factors GT-1 and GBF RL Plant Mol Biol 39:1299-1310 (1999) RD PubMed: 10380815; XX RA Menkens AE, Schindler U, Cashmore AR RT The G-box: a ubiquitous regulatory DNA element in plants bound by RT the GBF family of bzip proteins RL Trends in Biochemistry 20:506-510 (1995) RC Review RD PubMed: 8571452; XX RA Chakravarthy S, Tuori RP, DAscenzo MD, Fobert PR, Despres C, RA Martin GB RT The tomato transcription factor Pti4 regulates defence-related RT gene expression via GCC box and non-GCC box cis elements RL Plant Cell 15: 3033-3050 (2003) RD PubMed: 14630974; XX RA Siberil Y, Benhamron S, Memelink J, Giglioli-Guivarc'h N, RA Thiersault M, Boisson B, Doireau P, Gantet P RT Catharanthus roseus G-box binding factors 1 and 2 act as RT repressors of strictosidine synthase gene expression in cell RT cultures RL Plant Mol Biol 45: 477-488 (2001) RD PubMed: 11352466; XX SQ CACGTG // ID CACTFTPPCA1 XX AC S000449 XX DT 19-August-2004 (last modified) kehi XX DE Tetranucleotide (CACT) is a key component of Mem1 (mesophyll DE expression module 1) found in the cis-regulatory element in the DE distal region of the phosphoenolpyruvate carboxylase (ppcA1) of DE the C4 dicot F. trinervia; Y=T/C; XX KW mesohpyll; CACT; XX OS Flaveria trinervia XX RA Gowik U, Burscheidt J, Akyildiz M, Schlue U, Koczor M, Streubel RA M, Westhoff P. RT cis-Regulatory elements for mesophyll-specific gene expression in RT the C4 plant Flaveria trinervia, the promoter of the C4 RT phosphoenolpyruvate carboxylase gene. RL Plant Cell. 16:1077-1090(2004) RD PubMed: 15100398 XX SQ YACT // ID CANBNNAPA XX AC S000148 XX DT 10-May-1998 (last modified) kehi XX DE Core of "(CA)n element" in storage protein genes in Brasica napus DE (B.n.); embryo- and endosperm-specific transcription of napin DE (storage protein) gene, napA; seed specificity; activator and DE repressor; XX KW (CA)n element; napA; napin; seed; storage protein; XX OS Brassica napus; XX RA Ellerstrom M, Stalberg K, Ezcurra I, Rask L RT Functional dissection of a napin gene promoter: identification of RT promoter elements required for embryo and endosperm-specific RT transcription. RL Plant Mol Biol 32:1019-1027 (1996) RD PubMed: 9002600; XX SQ CNAACAC // ID CAREOSREP1 XX AC S000421 XX DT 28-November-2004 (last modified) kehi XX DE "CAREs (CAACTC regulatory elements)" found in the promoter region DE of a cystein proteinase (REP-1) gene in rice; XX KW aleurone; GARE; gibberellin; seed; XX OS Oryza sativa (rice) XX RA Sutoh K, Yamauchi D. RT Two cis-acting elements necessary and sufficient for RT gibberellin-upregulated proteinase expression in rice seeds RL Plant J. 34:635-645 (2003) RD PubMed: 12787245; XX SQ CAACTC // ID CARG1ATAP3 XX AC S000347 XX DT 31-May-2006 (last modified) kehi XX DE "CArG1" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene DE promoter; Binding site of AP3/PI heterodimer; Binding site of DE AP3/PI heterodimer; Binding site for a positively acting factors; DE MADS domain transcription factors bind with a consensus sequence DE called the CArG box; See S000348, S000349; XX KW APETALA3; MADS; CArG box; PI; flower; XX OS Arabidopsis thaliana XX RA Tilly JJ, Allen DW, Jack T RT The CArG boxes in the promoter of the Arabidopsis floral organ RT identity gene APETALA3 mediate diverse regulatory effects RL Development 125: 1647-1657 (1998) RD PubMed: 9521903; XX RA Hill TA, Day CD, Zondlo SC, Thackeray AG, Irish VF RT Discrete spatial and temporal cis-acting elements regulate RT transcription of the Arabidopsis floral homeotic gene APETALA3 RL Development125: 1711-1721 (1998) RD PubMed: 9521909; XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231 (2006) RC Review RD PubMed: 16616581 XX SQ GTTTACATAAATGGAAAA // ID CARG2ATAP3 XX AC S000348 XX DT 31-May-2006 (last modified) kehi XX DE "CArG2" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene DE promoter; Mutations in CArG2 result in a decrease in the DE expression in petals, but the expression pattern in stamens is DE unchanged; See S000348, S000349; XX KW APETALA3; MADS; CArG box; PI; flower; XX OS Arabidopsis thaliana XX RA Tilly JJ, Allen DW, Jack T RT The CArG boxes in the promoter of the Arabidopsis floral organ RT identity gene APETALA3 mediate diverse regulatory effects RL Development 125: 1647-1657 (1998) RD PubMed: 9521903; XX RA Hill TA, Day CD, Zondlo SC, Thackeray AG, Irish VF RT Discrete spatial and temporal cis-acting elements regulate RT transcription of the Arabidopsis floral homeotic gene APETALA3 RL Development125: 1711-1721 (1998) RD PubMed: 9521909; XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231(2006) RD PubMed: 16616581 XX SQ CTTACCTTTCATGGATTA // ID CARG3ATAP3 XX AC S000349 XX DT 31-May-2006 (last modified) kehi XX DE "CArG3" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene DE promoter; Binding site of AP3/PI heterodimer; Binding site for a DE negatively acting factors; Binding sequence of Arabidopsis (A.t.) DE MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and DE AGAMOUS; AP1, AG, and AP3-PI complexes induce similar DE conformational changes on a CArG-box sequence; See S000347, DE S000348, S000338; XX KW APETALA3; MADS; CArG box; PI; PISTILLATA; APETALA1; flower; XX OS Arabidopsis thaliana XX RA Tilly JJ, Allen DW, Jack T RT The CArG boxes in the promoter of the Arabidopsis floral organ RT identity gene APETALA3 mediate diverse regulatory effects RL Development 125: 1647-1657 (1998) RD PubMed: 9521903; XX RA Hill TA, Day CD, Zondlo SC, Thackeray AG, Irish VF RT Discrete spatial and temporal cis-acting elements regulate RT transcription of the Arabidopsis floral homeotic gene APETALA3 RL Development125: 1711-1721 (1998) RD PubMed: 9521909; XX RA Riechmann JL, Wang M, Meyerowitz EM RT DNA-binding properties of Arabidopsis MADS domain homeotic RT proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS RL Nucleic Acids Res 24: 3134-3141 (1996) RD PubMed: 8774892; XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231(2006) RD PubMed: 16616581 XX SQ CTTTCCATTTTTAGTAAC // ID CARGATCONSENSUS XX AC S000404 XX DT 31-May-2006 (last modified) kehi XX DE "CArG consensus" sequence found in the promoter of Arabidopsis DE (A.t.) SOC1 which is the MADS-box flowering-time gene; FLC is a DE component of the vernalization (low-temperature) pathway binds DE directly to this site and blocks transcriptional activation of DE SOC1 by CONSTANS (CO); See also S000342 (AGAMOUSATCONSENSUS); DE W=A/T; XX KW SOC1; Flowering time; CONSTANS; FLC; XX OS Arabidopsis thaliana XX RA Hepworth SR, Valverde F, Ravenscroft D, Mouradov A, Coupland G RT Antagonistic regulation of flowering-time gene SOC1 by CONSTANS RT and FLC via separate promoter motifs RL EMBO J. 21: 4327-4337 (2002) RD PubMed: 12169635; XX RA Michaels SD, Ditta G, Gustafson-Brown C, Pelaz S, Yanofsky M, RA Amasino RM. RT AGL24 acts as a promoter of flowering in Arabidopsis and is RT positively regulated by vernalization. RL Plant J. 33: 867-874 (2003) RD PubMed: 12609028; XX RA Hong RL, Hamaguchi L, Busch MA, Weigel D. RT Regulatory elements of the floral homeotic gene AGAMOUS RT identified by phylogenetic footprinting and shadowing. RL Plant Cell 15:1296-1309 (2003) RD PubMed: 12782724 XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231(2006) RC Review RD PubMed: 16616581 XX SQ CCWWWWWWGG // ID CARGCW8GAT XX AC S000431 XX DT 31-May-2006 (last modified) kehi XX DE A variant of CArG motif (see S000404), with a longer A/T-rich DE core; Binding site for AGL15 (AGAMOUS-like 15); W=A/T; XX KW CArG; AGL15; AGAMOUS; MADS; XX OS Arabidopsis thaliana XX RA Tang W, Perry SE. RT Binding site selection for the plant MADS domain protein AGL15: RT an in vitro and in vivo study. RL J Biol Chem.278:28154-28159 (2003) RD PubMed: 12743119; XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231 (2006) RC review RD PubMed: 16616581 XX SQ CWWWWWWWWG // ID CARGNCAT XX AC S000446 XX DT 31-May-2006 (last modified) kehi XX DE Noncanonical CArG motif (CC-Wx8-GG) found in the promoter region DE of DTA1 (AtGA2ox6); A relevant cis element for the response to DE AGL15 (AGAMOUS-like 15) in vivo; W=A/T; See S000431 (C-Wx8-G), DE S000404 (CArG consensus; CC-Wx6-GG); XX KW MADS; AGAMOUS; AGL; embryo; XX OS Arabidopsis thaliana; XX RA Wang H, Caruso LV, Downie AB, Perry SE. RT The embryo MADS domain protein AGAMOUS-Like 15 directly regulates RT expression of a gene encoding an enzyme involved in gibberellin RT metabolism. RL Plant Cell 16:1206-1219 (2004) RD PubMed: 15084721 XX RA Folter S, Angenent GC. RT trans meets cis in MADS science. RL Trends Plant Sci. 11:224-231 (2006) RC review RD PubMed: 16616581 XX SQ CCWWWWWWWWGG // ID CATATGGMSAUR XX AC S000370 XX DT 11-Mar-2001 (last modified) kehi XX DE Sequence found in NDE element in soybean (G.m.) SAUR (Small DE Auxin-Up RNA) 15A gene promoter; Involved in auxin DE responsiveness; See S000359, S000360; XX KW SAUR; NDE; auxin; XX OS soybean (Glycine max) XX RA Xu N, Hagen G, Guilfoyle T RT Multiple auxin response modules in the soybean SAUR 15A promoter RL Plant Sci 126: 193-201 (1997) XX SQ CATATG // ID CBFHV XX AC S000497 XX DT 22-June-2006 (last modified) kehi XX DE Binding site of barley (H.v.) CBF1, and also of barley CBF2; CBF DE = C-repeat (CRT) binding factors; CBFs are also known as DE dehydration-responsive element (DRE) binding proteins (DREBs); DE See also S000411 (SQ=GTCGAC); R=A/G; Y=C/T; XX KW CBF; AP2 domain; CRT/DRE; low temperature; XX OS Hordeum vulgare (barley) XX RA Xue GP RT Characterisation of the DNA-binding profile of barley HvCBF1 RT using an enzymatic method for rapid, quantitative and RT high-throughput analysis of the DNA-binding activity. RL Nucleic Acids Res. 30: e77 (2002) RD PubMed: 12140339 XX RA Svensson JT, Crosatti C, Campoli C, Bassi R, Stanca AM, Close TJ, RA Cattivelli L. RT Transcriptome analysis of cold acclimation in barley albina and RT xantha mutants. RL Plant Physiol. 141:257-270. (2006) RD PubMed: 16603669 XX SQ RYCGAC // ID CCA1ATLHCB1 XX AC S000149 XX DT 10-May-1998 (last modified) kehi XX DE CCA1 binding site; CCA1 protein (myb-related transcription DE factor) interact with two imperfect repeats of AAMAATCT in DE Lhcb1*3 gene of Arabidopsis thaliana (A.t.); Related to DE regulation by phytochrome; XX KW CCA1; Lhcb; shoot; leaf; XX OS Arabidopsis thaliana; XX RA Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM RT A myb-related transcription factor is involved in the phytochrome RT regulation of an Arabidopsis Lhcb gene. RL Plant cell 9:491-507 (1997) RD PubMed: 9144958; XX SQ AAMAATCT // ID CCAATBOX1 XX AC S000030 XX DT 04-January-2007 (last modified) kehi XX DE Common sequence found in the 5'-non-coding regions of eukaryotic DE genes; "CCAAT box" found in the promoter of heat shock protein DE genes; Located immediately upstream from the most distal HSE of DE the promoter; "CCAAT box" act cooperatively with HSEs to increase DE the hs promoter activity; XX KW HSE (Heat shock element); CCAAT box; XX OS eukaryotes; Glycine max (Soybean) XX RA Rieping M, Schoffl F RT Synergistic effect of upstream sequences, CCAAT box elements, and RT HSE sequences for enhanced expression of chimaeric heat shock RT genes in transgenic tobacco RL Mol Gen Genet. 231: 226-232 (1992) RD PubMed: 1736093; XX RA Haralampidis K, Milioni D, Rigas S, Hatzopoulos P RT Combinatorial interaction of cis elements specifies the RT expression of the Arabidopsis AtHsp90-1 gene RL Plant Physiol. 129: 1138-1149 (2002) RD PubMed: 12114568; XX RA Wenkel S, Turck F, Singer K, Gissot L, Le Gourrierec J, Samach A, RA Coupland G. RT CONSTANS and the CCAAT Box Binding Complex Share a Functionally RT Important Domain and Interact to Regulate Flowering of RT Arabidopsis. RL Plant Cell. 18:2971-2984 (2006) RD PubMed: 17138697 XX SQ CCAAT // ID CCTCGTGTCTCGMGH3 XX AC S000369 XX DT 16-Feb-2001 (last modified) seki XX DE Sequence found in D1 element in Soybean (G.m.) GH3 gene promoter; DE Showed constitutive activity with TGTCTC element (See S000270); DE Confers auxin inducibility; Binding site of nuclear protein; See DE also S000368; XX KW D1; D4; GH3; Auxin; XX OS Soybean (Glycine max) XX RA Ulmasov T, Liu ZB, Hagen G, Guilfoyle TJ RT Composite structure of auxin response elements RL Plant Cell 7: 1611-1623 (1995) RD PubMed: 7580254; XX SQ CCTCGTGTCTC // ID CDA1ATCAB2 XX AC S000440 XX DT 28-Jan-2004 (last modified) kehi XX DE CDA-1 (CAB2 DET1-associated factor 1) binding site in DtRE (dark DE response element) f of chlorophyll a/b-binding protein2 (CAB2) DE gene in Arabidopsis; XX KW dark response; CAB2; XX OS Arabidopsis thaliana XX RA Maxwell BB, Andersson CR, Poole DS, Kay SA, Chory J. RT HY5, circadian clock-assosiated 1, and a cis-lelement, DET1 dark RT response element, mediate DET1 regulation of chlorophyll RT a/b-binding protein2 expression. RL Plant Physiol. 133: 1565-1577 (2003) RD PubMed: 14563928; XX SQ CAAAACGC // ID CE3OSOSEM XX AC S000282 XX DT 16-Feb-2001 (last modified) seki XX DE "CE3 (Coupling Element 3)" found in the promoter of the rice DE (O.s.) Osem gene; Required for ABA-responsiveness and VP1 DE activation; Binding site of TRAB1; Motif A and CE3 (S000281) are DE functionally equivalent; TRAB1, bZIP transcription factor, DE interacts with VP1 and mediates abscisic acid-induced DE transcritption; XX KW CE3; Motif A; AVRE; CE3; ABA; VP1; TRAB1; Osem; Em; bZIP; seed; XX OS rice (Oryza sativa) XX RA Hobo T, Asada M, Kowyama Y, Hattori T RT ACGT-containing abscisic acid response element (ABRE) and RT coupling element 3 (CE3) are functionally equivalent RL Plant J 19: 679-689 (1999) RD PubMed: 10571853; XX RA Hobo T, Kowyama Y, Hattori T RT A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic RT acid-induced transcription RL Proc Natl Acad Sci USA 96: 15348-15353 (1999) RD PubMed: 10611387; XX SQ AACGCGTGTC // ID CELLCYCLESC XX AC S000031 XX DT 17-May-1998 (last modified) kehi XX DE "cell cycle box" found in URS2 (-940/-200) of HO gene of DE S.cerevisiae; cell-cycle-specific activation of transcription; XX KW cell cycle box; URS2; HO gene; XX OS yeast (Saccharomyces cerevisiae) XX RA Breeden L, Nasmyth K RT Cell cycle control of the yeast HO gene: cis- and trans-acting RT regulators. RL Cell 48:389-397 (1987) RD PubMed: 3542227; XX RA Nasmyth K, Adolf G, Lydall D, Seddon A RT The identification of a second cell cycle control on the HO RT promoter in yeast: cell cycle regulation of SW15 nuclear entry. RL Cell 62:631-647 (1990) RD PubMed: 2167175; XX SQ CACGAAAA // ID CEREGLUBOX1PSLEGA XX AC S000032 XX DT 17-May-1998 (last modified) kehi XX DE "cereal glutenin box" in pea legumin gene (legA); sequence DE homologous to the cereal glutenin gene control element ("-300 DE element"); XX KW cereal; glutenin; legumin; legA; seed; XX OS pea (Pisum sativum) XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX SQ TGTTAAAGT // ID CEREGLUBOX2PSLEGA XX AC S000033 XX DT 17-May-1998 (last modified) kehi XX DE "cereal glutenin box" in pea legumin gene (legA); sequence DE homologous to the cereal glutenin gene control element ("-300 DE element"); XX KW legumin; glutenin; cereal; legA; seed; XX OS pea (Pisum sativum) XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX SQ TGAAAACT // ID CEREGLUBOX3PSLEGA XX AC S000034 XX DT 17-May-1998 (last modified) kehi XX DE "cereal glutenin box" in pea (P.s.) legumin gene (legA); sequence DE homologous to the cereal glutenin gene control elements; XX KW legumin; cereal; glutenin; seed; XX OS pea (Pisum sativum) XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX SQ TGTAAAAGT // ID CGACGOSAMY3 XX AC S000205 XX DT 17-May-1998 (last modified) kehi XX DE "CGACG element" found in the GC-rich regions of the rice (O.s.) DE Amy3D and Amy3E amylase genes, but not in Amy3E gene; May DE function as a coupling element for the G box element; XX KW amylase; XX OS rice (Oryza sativa); XX RA Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL RT Three cis-elements required for rice alpha-amylase Amy3D RT expression during sugar starvation RL Plant Mol Biol 36:331-341 (1998) RD PubMed: 9484474; XX SQ CGACG // ID CGCGBOXAT XX AC S000501 XX DT 04-August-2006 (last modified) kehi XX DE "CGCG box" recognized by AtSR1-6 (Arabidopsis thaliana DE signal-responsive genes); Multiple CGCG elements are found in DE promoters of many genes; Ca++/calmodulin binds to all AtSRs; DE V=A/C/G; B=G/T/C; XX KW calmodulin XX OS Arabidopsis thaliana XX RA Yang T, Poovaiah BW. RT A calmodulin-binding/CGCG box DNA-binding protein family involved RT in multiple signaling pathways in plants. RL J Biol Chem. 277:45049-45058. (2002) RD PubMed: 12218065 XX SQ VCGCGB // ID CGF1ATCAB2 XX AC S000213 XX DT 11-May-2006 (last modified) kehi XX DE CGF-1 binding site in the Arabidopsis (A.t.) cab2 gene promoter; DE CGF-1=CAB GATA Factor 1; Found at -74 to -42; Contains a highly DE conserved, repeated GATA motif termed I-box (see S000124, DE S000199); For GATA motif, see S000039; The binding specificity of DE CGF-1 appears to be related to GT-family of DNA-binding proteins; DE For a compilation of related GT elements and factors, see Villain DE et al. (1996); XX KW CGF; cab; cab2; CGF-1; GT; leaf; shoot; XX OS Arabidopsis thaliana; XX RA Anderson SL, Teakle GR, Martino-Catt SJ, Kay SA RT Circadian clock- and phytochrome-regulated transcription is RT conferred by a 78 bp cis-acting domain of the Arabidopsis CAB2 RT promoter RL Plant J 6:457-470 (1994) RD PubMed: 7987408; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC review RD PubMed: 10366876 XX SQ GATAAAGATTACTTCAGATATAACAAACGTTAC // ID CGTGTSPHZMC1 XX AC S000294 XX DT 10-Feb-2000 (last modified) seki XX DE Sequence found in the maize (Z.m.) C1 gene promoter; Located DE between -147 to -132; Containing Sph element; Required for ABA DE responsiveness; See S000154, S000293; XX KW C1; anthocyanin pathway; ABA; VP1; light; Sph; XX OS maize (Zea mays) XX RA Kao CY, Cocciolone SM, Vasil IK, McCarty DR RT Localization and interaction of the cis-acting elements for RT abscisic acid, VIVIPAROUS1, and light activation of the C1 gene RT of maize RL Plant Cell 8: 1171-1179 (1996) RD PubMed: 8768375 XX SQ CGTGTCGTCCATGCAT // ID CIACADIANLELHC XX AC S000252 XX DT 11-Oct-1999 (last modified) kehi XX DE Region necessary for circadian expression of tomato (L.e.) Lhc DE gene; XX KW circadian; light; Lhc; leaf; shoot; XX OS tomato (Lycopersicon esculentum) XX RA Piechulla B, Merforth N, Rudolph B RT Identification of tomato Lhc promoter regions necessary for RT circadian expression RL Plant Mol Biol 38:655-662 (1998) RD PubMed: 9747810; XX SQ CAANNNNATC // ID CMSRE1IBSPOA XX AC S000511 XX DT 04-January-2007 (last modified) kehi XX DE CMSRE-1 (Carbohydrate Metabolite Signal Responsive Element 1) DE found in the promoter of sweet potato (I.b.) sporamin A gene; XX KW sucrose; sporamin; sugar-induced; SpoA; XX OS Ipomoea batatas (sweet potato) XX RA Morikami A, Matsunaga R, Tanaka Y, Suzuki S, Mano S, Nakamura K. RT Two cis-acting regulatory elements are involved in the RT sucrose-inducible expression of the sporamin gene promoter from RT sweet potato in transgenic tobacco. RL Mol Genet Genomics. 272:690-699 (2005) RD PubMed: 15654621 XX SQ TGGACGG // ID CONSERVED11NTZMATP1 XX AC S000301 XX DT 10-Feb-2000 (last modified) seki XX DE Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial DE atp1 promoter; Located between -5 and +6; Essential for the DE expression; XX KW mitochondria; atp1; XX OS maize (Zea mays) XX RA Rapp WD, Stern DB RT A conserved 11 nucleotide sequence contains an essential promoter RT element of the maize mitochondrial atp1 gene RL EMBO J 11: 1065-1073 (1992) RD PubMed: 1372246 XX SQ ACGTATTAAAA // ID COREOS XX AC S000469 XX DT 24-April-2005 (last modified) kehi XX DE CORE (coordinate regulatory element for antioxidant defense) DE conserved on the promoter regions of three antioxidant defense DE genes in rice: cytosolic superoxide dismutase, cytosolic DE thioredoxin, and glutaredoxin; K=T/G; W=T/A; Y=T/C; R=A/G; DE M=C/A; XX KW oxidative stress; antioxidant; XX OS Oryza sativa (rice) XX RA Tsukamoto S, Morita S, Hirano E, Yokoi H, Masumura T, Tanaka K. RT A novel cis-element that is responsive to oxidative stress RT regulates three antioxidant defense genes in rice. RL Plant Physiol. 137: 317-327.(2005) RD PubMed: 15618434 XX SQ AAKAATWYRTAWATAAAAMTTTTATWTA // ID CPBCSPOR XX AC S000491 XX DT 30-November-2005 (last modified) kehi XX DE The sequence critical for Cytokinin-enhanced Protein Binding in DE vitro, found in -490 to -340 of the promoter of the cucumber (CS) DE POR (NADPH-protochlorophyllide reductase) gene; XX KW cytokinin; chlorophyll; chloroplast; XX OS Cucumis sativus L. (cucumber) XX RA Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K. RT Identification of a Novel Cis-Element Exhibiting RT Cytokinin-Dependent Protein Binding in Vitro in the 5'-region of RT NADPH-Protochlorophyllide Oxidoreductase Gene in Cucumber. RL Plant Mol Biol. 59: 631-645 (2005). RD PubMed: 16244912 XX SQ TATTAG // ID CPRFPCCHS XX AC S000313 XX DT 8-February-2006 (last modified) kehi XX DE "BoxII"; Binding site of CPRF-1, -2, -3 and -4(Common Plant DE Regulatory Factor) in the parsley (P.c.) light responsive DE chalcone synthase (CHS) gene promoter; CPRF proteins are bZIP DE class transcription factors; CPRF proteins participates in the DE light-mediated activation of the CHS gene in parsley; "ACE"; The DE proline-rich domains of CPRF1 and 4 activate transcription; DE CPRF1-containing bZIP heterodimer interacts with ACE in vivo; XX KW BoxII; CPRF; bZIP; leaf; shoot; CHS; ACE; light; bZIP; XX OS Parsley (Petroselinum crispum) XX RA Weisshaar B, Armstrong GA, Block A, da Costa e Silva O, Hahlbrock RA K. RT Light-inducible and constitutively expressed DNA-binding proteins RT recognizing a plant promoter element with functional relevance in RT light responsiveness RL EMBO J 10: 1777-1786 (1991) RD PubMed: 2050115; XX RA Sprenger-Haussels M, Weisshaar B RT Transactivation properties of parsley proline-rich bZIP RT transcription factors RL Plant J 22: 1-8 (2000) RD PubMed: 10792815; XX SQ CCACGTGGCC // ID CRTDREHVCBF2 XX AC S000411 XX DT 22-June-2006 (last modified) kehi XX DE Preferred sequence for AP2 transcriptional activator HvCBF2 of DE barley; "Core CRT/DRE motif"; HvCBF2 bound to a (G/a)(T/c)CGAC DE core motif (Xue, 2003); DNA binding is regulated by temperature; DE This motif was erroneously ID-labeled in PLACEdb as CDTDREHVCBF2, DE and was corrected on 22 June, 2006; XX KW cold; AP2; CRT/DRE; CBF; XX OS Hordeum vulgare (barley) XX RA Xue GP RT The DNA-binding activity of an AP2 transcriptional activator RT HvCBF2 involved in regulation of low-temperature responsive genes RT in barley is modulated by temperature. RL Plant J. 33: 373-383 (2003) RD PubMed: 12535350; XX SQ GTCGAC // ID CTRMCAMV35S XX AC S000460 XX DT 27-March-2004 (last modified) kehi XX DE CT-rich motif (inverted GAGA) found in a 60-nucleotide region DE (S1) downstream of the transcription start site of the CaMV 35S DE RNA; Can enhance gene expression; Inverted GAGA; See also DE S000405, S000427 (GAGA); (TC)4T; XX KW CaMV 35S; enhancer; XX OS Cauliflower mosaic virus (CaMV) XX RA Pauli S, Rothnie HM, Chen G, He X, Hohn T. RT The cauliflower mosaic virus 35S promoter extends into the RT transcribed region. RL J Virol. 78: 12120-12128.(2004) RD PubMed: 15507598 XX SQ TCTCTCTCT // ID CURECORECR XX AC S000493 XX DT 11-April-2006 (last modified) kehi XX DE GTAC is the core of a CuRE (copper-response element) found in DE Cyc6 and Cpx1 genes in Chlamydomonas; Also involved in DE oxygen-response of these genes; For CuRE, see Quin and Merchant, DE 1995; XX KW copper; oxygen; hypoxic; XX OS Chlamydomonas reinhardtii XX RA Quinn JM, Barraco P, Eriksson M, Merchant S. RT Coordinate copper- and oxygen-responsive Cyc6 and Cpx1 expression RT in Chlamydomonas is mediated by the same element. RL J Biol Chem. 275: 6080-6089 (2000). RD PubMed: 10692397 XX RA Quinn JM, Eriksson M, Moseley JL, Merchant S. RT Oxygen deficiency responsive gene expression in Chlamydomonas RT reinhardtii through a copper-sensing signal transduction RT pathway. RL Plant Physiol. 128 :463-471 (2002). RD PubMed: 11842150 XX RA Quinn JM, Merchant S. RT Two copper-responsive elements associated with the Chlamydomonas RT Cyc6 gene function as targets for transcriptional activators. RL Plant Cell. 7 :623-628 (1995). RD PubMed: 7780310 XX RA Kropat J, Tottey S, Birkenbihl RP, Depege N, Huijser P, Merchant RA S. RT A regulator of nutritional copper signaling in Chlamydomonas is RT an SBP domain protein that recognizes the GTAC core of copper RT response element. RL Proc Natl Acad Sci U S A. 102: 18730-18735.(2005) RD PubMed: 16352720 XX SQ GTAC // ID CYTOSITECSHPRA XX AC S000261 XX DT 14-Oct-1999 (last modified) kehi XX DE 13 bp sequence of unknown function found in cucumber (C.s.) DE hydroxypyruvate reductase (hprA) gene promoter; Protein binding DE site; Required for cytokinin responsiveness; See S000260 DE (AS1LIKECSHPRA) found in the same region; Also involved in light DE responsiveness; see also S000260; XX KW cytokinin; as-1; light; XX OS cucumber (Cucumis sativus) XX RA Jin G, Davey MC, Ertl JR, Chen R, Yu Z, Daniel SG, Becker WM, RA Chen C RT Interaction of DNA-binding proteins with the 5'-flanking region RT of a cytokinin-responsive cucumber hydroxypyruvate reductase RT gene RL Plant Mol Biol 38:713-724 (1998) RD PubMed: 9862489; XX SQ AAGATTGATTGAG // ID D1GMAUX28 XX AC S000328 XX DT 20-Feb-2002 (last modified) uchi XX DE "D1"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; D1 and D4 share a very DE similar core sequence TAGTXXCTGT and TAGTXCTGT, respectively; DE D1/D4-like sequence were identified in several other DE auxin-responsive genes; Binding site of GmGT-2 which is the GT-2 DE family of transcription factors; GmGT-2 are down-regulated by DE light in a phytochrome-dependent manner; See 000331; XX KW Auxin; Aux28; GT-2; phytochrome; D1; hypocotyl; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX RA O'Grady K, Goekjian VH, Naim CJ, Nagao RT, Key JL RT The transcript abundance of GmGT-2, a new member of the GT-2 RT family of transcription factors from soybean, is down-regulated RT by light in a phytochrome-dependent manner RL Plant Mol Biol 47: 367-378 (2001) RD PubMed: 11587508; XX SQ ACAGTTACTA // ID D2GMAUX28 XX AC S000329 XX DT 7-Sep-2000 (last modified) seki XX DE "D2"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; Located between -703 and DE -716; A/T-rich sequence; XX KW Auxin; Aux28; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ ATTTATATAAAT // ID D3GMAUX28 XX AC S000330 XX DT 7-Sep-2000 (last modified) seki XX DE "D3"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; Located between -750 and DE -760; A/T-rich sequence; XX KW Auxin; Aux28; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ TATTTGCTTAA // ID D4GMAUX28 XX AC S000331 XX DT 7-Sep-2000 (last modified) seki XX DE "D4"; DNase I protected sequence found in the soybean (G.m.) DE auxin responsive gene, Aux28, promoter; D1 and D4 share a very DE similar core sequence TAGTXXCTGT and TAGTXCTGT, respectively; DE D1/D4-like sequence were identified in several other DE auxin-responsive genes; See 000328; XX KW Auxin; Aux28; XX OS soybean (Glycine max) XX RA Nagao RT, Goekjian VH, Hong JC, Key JL RT Identification of protein-binding DNA sequences in an RT auxin-regulated gene of soybean RL Plant Mol Biol 21: 1147-1162 (1993) RD PubMed: 8490133; XX SQ TAGTGCTGT // ID DE1PSPRA2 XX AC S000379 XX DT 21-May-2001 (last modified) uchi XX DE "DE1" found in the pea(P.S) pra2 gene promoter; Involved in pra2 DE down-regulation by phytochrome A, phytochrome B and blue-light DE photoreceptors; pra2 encodes a small GTPase belonging to the DE YPT/rab family; DF1 has DNA-binding domain specifically binds to DE two types of DNA sequences, DE1 and GT2; XX KW pra2; light response; dark induction; down regulation; DF1; XX OS pea (Pisum sativum) XX RA Inaba T, Nagano Y, Reid JB, Sasaki Y RT DE1, a 12-base pair cis-regulatory element sufficient to confer RT dark-inducible and light down-regulated expression to a minimal RT promoter in pea RL J Biol Chem 275: 19723-19727 (2000) RD PubMed: 10777499; XX RA Nagano Y, Inaba T, Furuhashi H, Sasaki Y RT Trihelix DNA-binding protein with specificities for two distinct RT cis-elements: both important for light down-regulated and RT dark-inducible gene expression in higher plants RL J Biol Chem 276: 22238-22243 (2001) RD PubMed: 11301338; XX SQ GGATTTTACAGT // ID DOFCOREZM XX AC S000265 XX DT 7-Sep-2000 (last modified) seki XX DE Core site required for binding of Dof proteins in maize (Z.m.); DE Dof proteins are DNA binding proteins, with presumably only one DE zinc finger, and are unique to plants; Four cDNAs encoding Dof DE proteins, Dof1, Dof2, Dof3 and PBF, have been isolated from DE maize; PBF is an endosperm specific Dof protein that binds to DE prolamin box; Maize Dof1 enhances transcription from the DE promoters of both cytosolic orthophosphate kinase (CyPPDK) and a DE non-photosynthetic PEPC gene; Maize Dof2 supressed the C4PEPC DE promoter; XX KW Dof; C4PEPC; CyPPDK; PEPC; C4; leaf; shoot; XX OS maize (Zea mays) XX RA Yanagisawa S, Schmidt RJ RT Diversity and similarity among recognition sequences of Dof RT transcription factors RL Plant J 17:209-214 (1999) RD PubMed: 10074718; XX RA Yanagisawa S RT Dof1 and Dof2 transcription factors are associated with RT expression of multiple genes involved in carbon metabolism in RT maize RL Plant J 21:281-288 (2000) RD PubMed: 10758479; XX SQ AAAG // ID DPBFCOREDCDC3 XX AC S000292 XX DT 7-Sep-2000 (last modified) seki XX DE A novel class of bZIP transcription factors, DPBF-1 and 2 (Dc3 DE promoter-binding factor-1 and 2) binding core sequence; Found in DE the carrot (D.c.) Dc3 gene promoter; Dc3 expression is normally DE embryo-specific, and also can be induced by ABA; The Arabidopsis DE abscisic acid response gene ABI5 encodes a bZIP transcription DE factor; abi5 mutant have a pleiotropic defects in ABA response; DE ABI5 regulates a subset of late embryogenesis-abundant genes; DE GIA1 (growth-insensitivity to ABA) is identical to ABI5; XX KW Dc3; lea class gene; embryo; ABA; DPBF-1, DPBF-2; bZIP; GIA1; KW ABI5; seed; XX OS carrot (Daucus carota); Arabidopsis thaliana; XX RA Kim SY, Chung HJ, Thomas TL RT Isolation of a novel class of bZIP transcription factors that RT interact with ABA-responsive and embryo-specification elements in RT the Dc3 promoter using a modified yeast one-hybrid system RL Plant J 11: 1237-1251 (1997) RD PubMed: 9225465 GenBank: AF061870, AF001454, AF001453 XX RA Finkelstein RR, Lynch TJ RT The Arabidopsis abscisic acid response gene ABI5 encodes a basic RT leucine zipper transcription factor RL Plant Cell 12: 599-609 (2000) RD PubMed: 10760247; XX RA Lopez-Molina L, Chua NH RT A null mutation in a bZIP factor confers ABA-insensitivity in RT Arabidopsis thaliana RL Plant Cell Physiol 41: 541-547 (2000) RD PubMed: 10929936; XX SQ ACACNNG // ID DR5GMGH3 XX AC S000337 XX DT 7-Sep-2000 (last modified) seki XX DE "DR5"; A highly active synthetic auxin response element; Created DE by site-directed mutations in a natural composite AuxRE found in DE the soybean GH3 promoter; The DR5 showed greater auxin DE responsiveness; Binding site of ARF1; See S000270; XX KW Aux/IAA; DR5; Auxin; ARF1; AUXRE; XX OS Soybean (Glycine max) XX RA Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ RT Aux/IAA proteins repress expression of reporter genes containing RT natural and highly active synthetic auxin response elements RL Plant Cell 9: 1963-1971 (1997) RD PubMed: 9401121; XX SQ CCTTTTGTCTC // ID DRE1COREZMRAB17 XX AC S000401 XX DT 27-Aug-2002 (last modified) uchi XX DE "DRE1" core found in maize (Z.M.) rab17 gene promoter; "DRE1" was DE protected, in in vivo footprinting, by a protein in embryos DE specifically, but in leaves, was protected when was treated with DE ABA and drought; rab17 is expressed during late embryogenesis, DE and is induced by ABA; See S000150, S000200 and S000402; XX KW rab17; ABA; drought response; XX OS maize (Zea mays) XX RA Busk PK, Jensen AB, Pages M RT Regulatory elements in vivo in the promoter of the abscisic acid RT responsive gene rab17 from maize RL Plant J. 11: 1285-1295 (1997) RD PubMed: 9225468; XX RA Kizis D, Pages M RT Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 RT regulation through the drought-responsive element in an RT ABA-dependent pathway RL Plant J. 30 :679-689 (2002) RD PubMed: 12061899; XX SQ ACCGAGA // ID DRE2COREZMRAB17 XX AC S000402 XX DT 03-Jun-2003 (last modified) kehi XX DE "DRE2" core found in maize (Z.M.) rab17 gene promoter; "DBF1" and DE "DBF2" bound to "DRE2"; rab17 is expressed during late DE embryogenesis, and is induced by ABA; See S000150, S000200 and DE S000401; XX KW rab17; ABA; drought response; DBF1; DBF2; XX OS maize (Zea mays) XX RA Busk PK, Jensen AB, Pages M RT Regulatory elements in vivo in the promoter of the abscisic acid RT responsive gene rab17 from maize RL Plant J. 11: 1285-1295 (1997) RD PubMed: 9225468; XX RA Kizis D, Pages M RT Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 RT regulation through the drought-responsive element in an RT ABA-dependent pathway RL Plant J. 30 :679-689 (2002) RD PubMed: 12061899; XX RA Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, RA Seki M, Shinozaki K, Yamaguchi-Shinozaki K. RT OsDREB genes in rice, Oryza sativa L., encode transcription RT activators that function in drought-, high-salt- and RT cold-responsive gene expression. RL Plant J. 33: 751-763 (2003) RD PubMed: 12609047; XX SQ ACCGAC // ID DRECRTCOREAT XX AC S000418 XX DT 30-January-2006 (last modified) kehi XX DE Core motif of DRE/CRT (dehydration-responsive element/C-repeat) DE cis-acting element found in many genes in Arabidopsis and in DE rice; R=G/A; Os DREB1A bound to GCCGAC more preferentially than DE to ACCGAC whereas At DREB1A bound to both GCCGAC and ACCGAC DE efficiently; See S000402 (ACCGAC); Maize ZmDREB1A bound to DRE DE (Qin et al. 2004); HaDREB2 in Helianthus annuus DE (sunflower)(Diaz-Martin et al. 2005); HaDREB2 physically interact DE with HaHSFA9 in vitro (Diaz-Martin et al. 2005); XX KW DRE/CRT; drought; high-light; cold; DREB; DREB1; DREB2; CBF; XX OS Oryza sativa (rice); Zea mays (maize); Helianthus annuus OS (sunflower); XX RA Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, RA Seki M, Shinozaki K, Yamaguchi-Shinozaki K. RT OsDREB genes in rice, Oryza sativa L., encode transcription RT activators that function in drought-, high-salt- and RT cold-responsive gene expression. RL Plant J. 33: 751-763 (2003) RD PubMed: 12609047; XX RA Qin F, Sakuma Y, Li J, Liu Q, Li YQ, Shinozaki K, RA Yamaguchi-Shinozaki K. RT Cloning and functional analysis of a novel DREB1/CBF RT transcription factor involved in cold-responsive gene expression RT in Zea mays L. RL Plant Cell Physiol. 45: 1042-1052 (2004). RD PubMed: 15356330 XX RA Diaz-Martin J, Almoguera C, Prieto-Dapena P, Espinosa JM, Jordano RA J RT Functional Interaction between Two Transcription Factors Involved RT in the Developmental Regulation of a Small Heat Stress Protein RT Gene Promoter RL Plant Physiology, 139: 1483-1494 (2005) RD PubMed: 16244139 XX RA Suzuki M, Ketterling MG, McCarty DR. RT Quantitative statistical analysis of cis-regulatory sequences in RT ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis. RL Plant Physiol.139: 437-447 (2005) RC in silico RD PubMed: 16113229 XX RA Skinner JS, von Zitzewitz J, Szucs P, Marquez-Cedillo L, RA Filichkin T, Amundsen K, Stockinger EJ, Thomashow MF, Chen TH, RA Hayes PM. RT Structural, functional, and phylogenetic characterization of a RT large CBF gene family in barley. RL Plant Mol Biol. 59: 533-551 (2005) RD PubMed: 16244905 XX SQ RCCGAC // ID DREDR1ATRD29AB XX AC S000152 XX DT 23-June-2006 (last modified) kehi XX DE Related to responsiveness to drought, low-temperature or DE high-salt stress; See S000153, S000157; Binding site of DREB1 and DE DREB2: Binding site of Arabidopsis CBF1(C-repeat/DRE binding DE factor); Overexpression of DREB1A activated the expression of DE stress tolerance genes; CBF1 overexpression induces COR genes and DE enhances freezing tolerance; Heterologous CBF1 expression DE enhances oxidative stresses tolerance; DRE and ABRE are DE interdependent in the ABA-responsive expression of the rd29A in DE Arabidopsis; XX KW DRE; drought; water stress; oxidative stress; low temperature; KW high salt; stress; LRE; DREB; C-repeat; CBF1; AP2; cold; KW dehydration; CRT; leaf; shoot; XX OS Arabidopsis thaliana; Populus spp.; XX RA Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K RT Improving plant drought, salt, and freezing tolerance by gene RT transfer of a single stress-inducible transcription factor RL Nat Biotechnol 17: 287-291 (1999) RD PubMed: 10096298; XX RA Suzuki M, Ketterling MG, McCarty DR. RT Quantitative statistical analysis of cis-regulatory sequences in RT ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis. RL Plant Physiol.139: 437-447 (2005) RC in silico RD PubMed: 16113229 XX RA Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe RA H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K. RT Interaction between two cis-acting elements, ABRE and DRE, in RT ABA-dependent expression of Arabidopsis rd29A gene in response to RT dehydration and high-salinity stresses. RL Plant J. 34: 137-148 (2003) RD PubMed: 12694590; XX RA Benedict C, Skinner JS, Meng R, Chang Y, Bhalerao R, Huner NPA, RA Finn CE, Chen THH, Hurry V RT The CBF1-dependent low temperature signalling pathway, regulon RT and increase in freeze tolerance are conserved in Populus spp. RL Plant, Cell and Environment 29:1259-1272 (2006) XX RA Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S. RT ABR1, an APETALA2-Domain Transcription Factor That Functions as a RT Repressor of ABA Response in Arabidopsis. RL Plant Physiol. 139: 1185-1193 (2005) RD PubMed: 16227468 XX RA Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, RA Yamaguchi-Shinozaki K RT Organization and expression of two Arabidopsis DREB2 genes RT encoding DRE-binding proteins involved in dehydration- and RT high-salinity-responsive gene expression RL Plant Mol Biol 42: 657-665 (2000) RD PubMed: 10809011; XX RA Hsieh TH, Lee JT, Yang PT, Chiu LH, Charng YY, Wang YC, Chan MT RT Heterology expression of the Arabidopsis C-repeat/dehydration RT response element binding factor 1 gene confers elevated tolerance RT to chilling and oxidative stresses in transgenic tomato RL Plant Physiol. 129: 1086-1094 (2002) RD PubMed: 12114563; XX SQ TACCGACAT // ID E2F1OSPCNA XX AC S000396 XX DT 21-May-2002 (last modified) uchi XX DE "re2f-1" found in the promoter of rice PCNA gene; Located between DE -142 and -135; "te2f-1" found in the promote of Tobacco PCBA DE gene; Located between -122 and -115; Binding site of OsE2F1 and DE OsE2F2; Involved in transcriptional activation in actively DE dividing cells and tissue; XX KW E2F; PCNA; meristematic tissue; cell cycle; XX OS rice (Oryza sativa); tobacco (Nicotiana tabacum) XX RA Kosugi S, Ohashi Y RT E2F sites that can interact with E2F proteins cloned from rice RT are required for meristematic tissue-specific expression of rice RT and tobacco proliferating cell nuclear antigen promoters RL Plant J 29: 45-59 (2002) RD PubMed: 12060226; XX SQ GCGGGAAA // ID E2FANTRNR XX AC S000366 XX DT 23-June-2006 (last modified) kehi XX DE "E2Fa element" found in the tobacco (N.t.) RNR (Ribonucleotide DE reductase) gene promoter and in the Arabidopsis thaliana (A.t.) DE CDC6 gene promoter; Binding site of tobacco and Arabidopsis E2F; DE Involved in upregulation of the promoter at G1/S transition; See DE S000367; XX KW E2Fa; RNR; G1/S transition; CDC6; Cell-division; Cell cycle; KW S-phase; cell suspension culture XX OS tobacco (Nicotiana tabacum); Arabidopsis thaliana; XX RA Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N RT Cell cycle regulation of the tobacco ribonucleotide reductase RT small subunit gene is mediated by E2F-like elements RL Plant Cell 12: 1987-2000 (2000) RD PubMed: 11041892; XX RA de Jager SM, Menges M, Bauer UM, Murra JA RT Arabidopsis E2F1 binds a sequence present in the promoter of RT S-phase-regulated gene AtCDC6 and is a member of a multigene RT family with differential activities RL Plant Mol Biol 47: 555-568 (2001) RD PubMed: 11669580; XX RA Sozzani R, Maggio C, Varotto S, Canova S, Bergounioux C, Albani RA D, Cella R RT Interplay between Arabidopsis Activating Factors E2Fb and E2Fa in RT Cell Cycle Progression and Development. RL Plant Physiol. 140: 1355-1366 (2006) XX SQ TTTCCCGC // ID E2FAT XX AC S000417 XX DT 03-Jun-2003 (last modified) kehi XX DE "E2F-binding site" found in many potential E2F target genes; most DE potential E2F targets identified in silico show a cell DE cycle-regulated expression; Y=T/C; see S000366; XX KW E2F; cell cycle; XX OS Arabidopsis thaliana XX RA Ramirez-Parra E, Frundt C, Gutierrez C. RT A genome-wide identification of E2F-regulated genes in RT Arabidopsis. RL Plant J. 33: 801-811 (2003) RD PubMed: 12609051; XX SQ TYTCCCGCC // ID E2FBNTRNR XX AC S000367 XX DT 29-November-2004 (last modified) kehi XX DE "E2Fb" found in the tobacco (N.t.) RNR (Ribonucleotide reductase) DE gene promoter; Binding site of tobacco E2F; Involved in DE upregulation of the promoter at G1/S transition; See S000366; DE "dE2F (distal reverse E2F element)" important for regulating DE specific RNR1a gene expression in respsonse to UV-C irradiation; DE See S000455; XX KW E2Fb; RNR; G1/S transition; dE2F; UV-C; ceel cycle; XX OS tobacco (Nicotiana tabacum) XX RA Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N RT Cell cycle regulation of the tobacco ribonucleotide reductase RT small subunit gene is mediated by E2F-like elements RL Plant Cell 12: 1987-2000 (2000) RD PubMed: 11041892; XX RA Lincker F, Philipps G, Chaboute ME. RT UV-C response of the ribonucleotide reductase large subunit RT involves both E2F-mediated gene transcriptional regulation and RT protein subcellular relocalization in tobacco cells. RL Nucleic Acids Res. 32: 1430-1438. (2004). RD PubMed: 14990748 XX SQ GCGGCAAA // ID E2FCONSENSUS XX AC S000476 XX DT 05-November-2005 (last modified) kehi XX DE "E2F consensus sequence" of all different E2F-DP-binding motifs DE that were experimentally verified in plants (Vandepoele et al., DE 2005); See also S000417, S000397, S000396, S000367, S000366; DE W=A/T; S=C/G; XX KW E2F XX OS Arabidopsis thaliana; Nicotiana tabacum (tobacco); Oryza sativa OS (rice); Nicotiana benthamiana; XX RA Vandepoele K, Vlieghe K, Florquin K, Hennig L, Beemster GT, RA Gruissem W, Van de Peer Y, Inze D, De Veylder L. RT Genome-wide identification of potential plant E2F target genes. RL Plant Physiol.139: 316-328. (2005) RD PubMed: 16126853 XX SQ WTTSSCSS // ID EBOXBNNAPA XX AC S000144 XX DT 02-August-2006 (last modified) kehi XX DE E-box of napA storage-protein gene of Brassica napus (B.n.); See DE S000042 (CACGTGMOTIF); see S000407 (Myc consensus: CANNTG); This DE sequence is also known as RRE (R response element)(Hartmann et DE al., 2005); XX KW napA; storage protein; ABRE; E-box; seed; XX OS Brassica napus; XX RA Stalberg K, Ellerstom M, Ezcurra I, Ablov S, Rask L RT Disruption of an overlapping E-box/ABRE motif abolished high RT transcription of the napA storage-protein promoter in transgenic RT Brassica napus seeds. RL Planta 199:515-519 (1996) RD PubMed: 8818291; XX RA Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B. RT Differential combinatorial interactions of cis-acting elements RT recognized by R2R3-MYB, BZIP, and BHLH factors control RT light-responsive and tissue-specific activation of RT phenylpropanoid biosynthesis genes. RL Plant Mol Biol. 57: 155-171 (2005). RD PubMed: 15821875 XX SQ CANNTG // ID EECCRCAH1 XX AC S000494 XX DT 24-April-2006 (last modified) kehi XX DE "EEC"; Consensus motif of the two enhancer elements, EE-1 and DE EE-2, both found in the promoter region of the Chlamydomonas Cah1 DE (encoding a periplasmic carbonic anhydrase); Binding site of Myb DE transcription factor LCR1 (see Yoshioka et al, 2004); N=A/G/C/T; XX KW low-CO2; XX OS Chlamydomonas reinhardtii XX RA Kucho K, Yoshioka S, Taniguchi F, Ohyama K, Fukuzawa H. RT Cis-acting elements and DNA-binding proteins involved in RT CO2-responsive transcriptional activation of Cah1 encoding a RT periplasmic carbonic anhydrase in Chlamydomonas reinhardtii. RL Plant Physiol. 133: 783-793 (2003). RD PubMed: 14555782 XX RA Yoshioka S, Taniguchi F, Miura K, Inoue T, Yamano T, Fukuzawa H. RT The novel Myb transcription factor LCR1 regulates the RT CO2-responsive gene Cah1, encoding a periplasmic carbonic RT anhydrase in Chlamydomonas reinhardtii. RL Plant Cell. 16: 1466-1477.(2004) RD PubMed: 15155888 XX SQ GANTTNC // ID EIN3ATERF1 XX AC S000332 XX DT 7-Sep-2000 (last modified) seki XX DE EIN3 (Ethylene-insensitive 3) binding site found in the promoter DE of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 DE recognizes its target as a homodimer; EIN3 is necessary and DE sufficient for ERF1 expression; Consititutive expression of ERF1 DE results in the activation of a variety of ethylene response genes DE and phenotype; ERF1 is a GCC-box binding site; ERF1 acts DE downstream of EIN3; XX KW EIN3; ERF1; Ethylene; XX OS Arabidopsis thaliana XX RA Solano R, Stepanova A, Chao Q, Ecker JR RT Nuclear events in ethylene signaling: a transcriptional cascade RT mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 RL Genes Dev. 12: 3703-3714 (1998) RD PubMed: 9851977; GenBank: AF076277; AF076278; XX SQ GGATTCAAGGGGCATGTATCTTGAATCC // ID ELEMENT1GMLBC3 XX AC S000319 XX DT 7-Sep-2000 (last modified) seki XX DE "Element 1" found in the promoter of soybean (G.m.) DE leghaemoglobin lbc3 gene; Binding site of nuclear extract from DE soybean nodules; Located at -223 to -246; Element 1 and Element 2 DE (S000320) bind to the same nodule specific factor; Element 1 and DE Element 2 share a common motif; See S000320; XX KW nodule; leghaemoglobin; lbc3; root; XX OS Soybean (Glycine max) XX RA Jensen EO, Marcker KA, Schell J, de Bruijn J RT Interaction of a nodule specific, trans-acting factor with RT distinct DNA elements in the soybean leghaemoglobin lbc3 5' RT upstream region RL EMBO J 7:1265-1271 (1988) XX SQ GATATATTAATATTTTATTTTATA // ID ELEMENT2GMLBC3 XX AC S000320 XX DT 7-Sep-2000 (last modified) seki XX DE "Element 2" found in the promoter of soybean (G.m.) DE leghaemoglobin lbc3 gene; Binding site of nuclear extract from DE soybean nodules; Located at -161 to -176; Element 1(S000319) and DE Element 2 (S000320) bind to the same nodule specific factor; DE Element 2 is highly conserved in other soybean lb gene promoter DE regions; See S000319; XX KW nodule; leghaemoglobin; lbc3; root; XX OS Soybean (Glycine max) XX RA Jensen EO, Marcker KA, Schell J, de Bruijn J RT Interaction of a nodule specific, trans-acting factor with RT distinct DNA elements in the soybean leghaemoglobin lbc3 5' RT upstream region RL EMBO J 7:1265-1271 (1988) XX SQ CTTAAATTATTTATTT // ID ELRE1PCPAL1 XX AC S000306 XX DT 10-Feb-2000 (last modified) seki XX DE One of two elicitor (ELRE) and light response elements (LRE) DE found in the parsley (P.c.) phenylalanine ammonia-lyase (PAL-1) DE gene promoter; Involved in UV light and elicitor responsiveness; DE Conserved in several elicitor or light-responsive genes; See DE S000307; XX KW phenylalanine ammonia-lyase (PAL); UV; elicitor; light; leaf; KW shoot; XX OS parsley (Petroselinum crispum) XX RA Lois R, Dietrich A, Hahlbrok K, Schulz W RT A phenylalanine ammonia-lyase gene from parsley: structure, RT regulation and identification of elicitor and light responsive RT cis-acting elements RL EMBO J 8: 1641-1648 (1989) RD PubMed: 2767049; GenBank: X15473, X16772 XX SQ CTCCAACAAACCCCTTC // ID ELRE2PCPAL1 XX AC S000307 XX DT 10-Feb-2000 (last modified) seki XX DE One of two elicitor (ELRE) and light response elements (LRE) DE found in the parsley (P.c.) phenylalanine ammonia-lyase (PAL-1) DE gene promoter; Involved in UV light and elicitor responsiveness; DE Conserved in several elicitor or light-responsive genes; See DE S000306; XX KW phenylalanine ammonia-lyase (PAL); UV; elicitor; light; leaf; KW shoot; XX OS parsley (Petroselinum crispum) XX RA Lois R, Dietrich A, Hahlbrok K, Schulz W RT A phenylalanine ammonia-lyase gene from parsley: structure, RT regulation and identification of elicitor and light responsive RT cis-acting elements RL EMBO J 8: 1641-1648 (1989) RD PubMed: 2767049; GenBank: X15473, X16772 XX SQ ATTCTCACCTACCA // ID ELRECOREPCRP1 XX AC S000142 XX DT 22-June-2006 (last modified) kehi XX DE ElRE (Elicitor Responsive Element) core of parsley (P.c.) PR1 DE genes; consensus sequence of elements W1 and W2 of parsley PR1-1 DE and PR1-2 promoters; Box W1 and W2 are the binding site of WRKY1 DE and WRKY2, respectively; ERE; "WA box"; One of the W boxes found DE in the Parsley (P.c.) WRKY1 gene promoter; Required for elicitor DE responsiveness; See S000310; "WC box" WB box (S000310) and WC box DE constitute a palindrome; WRKY1 protein binding site; W-box found DE in thioredoxin h5 gene in Arabidopsis (Laloi et al.); XX KW Elicitor; PR1; ElRE; ELRE; ERE; W box; WRKY1; palindrome; KW salicylic acid; TMV; XX OS Petroselinum crispum (parsley); Nicotiana tabacum (tobacco); XX RA Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, RA Somssich IE RT Interaction of elicitor-induced DNA-binding proteins with RT elicitor response elements in the promoters of parsley PR1 RT genes. RL EMBO J 15:5690-5700 (1996) RD PubMed: 8896462; GenBank: U48862, U48863; XX RA Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE RT Early nuclear events in plant defence signalling: rapid gene RT activation by WRKY transcription factors RL EMBO J 18: 4689-4699 (1999) RD PubMed: 10469648; XX RA Eulgem T, Rushton PJ, Robatzek S, Somssich IE RT The WRKY superfamily of plant transcription factors RL Trends Plant Sci 5: 199-206 (2000) RC Review RD PubMed: 10785665; XX RA Chen C, Chen Z RT Isolation and characterization of two pathogen- and salicylic RT acid-induced genes encoding WRKY DNA-binding proteins from RT tobacco RL Plant Mol Biol 42: 387-396 (2000) RD PubMed: 10794538; XX RA Rushton PJ, Reinstadler A, Lipka V, Lippok B, Somssich IE RT Synthetic plant promoters containing defined regulatory elements RT provide novel insights into pathogen- and wound-induced RT signaling RL Plant Cell. 14: 749-762 (2002) RD PubMed: 11971132; XX RA Laloi C, Mestres-Ortega D, Marco Y, Meyer Y, Reichheld JP. RT The Arabidopsis cytosolic thioredoxin h5 gene induction by RT oxidative stress and its W-box-mediated response to pathogen RT elicitor. RL Plant Physiol. 134:1006-1016 (2004). RD PubMed: 14976236 XX SQ TTGACC // ID ELRENTCHN50 XX AC S000155 XX DT 17-May-1998 (last modified) kehi XX DE Elicitor-responsive element (ElRE); Found in tobacco (N. t.) DE basic class I chitinase gene (CHN50); XX KW ELRE; elicitor; chitinase; XX OS tobacco (Nicotiana tabacum); XX RA Fukuda Y RT Interaction of tobacco nuclear protein with an RT elicitor-responsive element in the promoter of a basic class I RT chitinase gene. RL Plant Mol Biol 34:81-87 (1997) RD PubMed: 9177314; XX SQ GGTCANNNAGTC // ID EMBP1TAEM XX AC S000119 XX DT 16-Feb-2001 (last modified) seki XX DE Binding site of trans-acting factor EMBP-1; wheat (T.a.) Em gene; DE See S000015; Binding site of ABFs; ABFs (ABRE binding factors) DE were isolated from Arabidopsis by a yeast one-hybrid screening DE system; Expression ABFs is induced by ABA and various stress DE treatment; ABFs belongs to a distinct subfamily of bZIP proteins; DE Involved in ABA-mediated stress-signaling pathway; XX KW EMBP-1; Em; ABA; ABF; ABRE; bZIP; seed; XX OS wheat (Triticum aestivum); Arabidopsis thaliana; XX RA Guiltinan MJ, Marcotte WR Jr, Quatrano RS RT A plant leucine zipper protein that recognizes an abscisic acid RT response element. RL Science 250:267-270 (1990) RD PubMed: 2145628; GenBank: M62893, M63999; XX RA Vasil V, Marcotte Jr. WR, Rosenkrans L, Cocciolone SM, Vasil IK, RA Quatrano RS, McCarty DR RT Overlap of viviparous1 (VP1) and abscisic acid response elements RT in the EM promoter: G-Box elements are sufficient but not RT necessary for VP1 transactivation RL Plant Cell 7: 1511-1518 (1995) RD PubMed: 8589631 XX RA Choi H, Hong J, Ha J, Kang J, Kim SY RT ABFs, a family of ABA-responsive element binding factors RL J Biol Chem 275: 1723-1730 (2000) RD PubMed: 10636868; XX SQ CACGTGGC // ID EMHVCHORD XX AC S000452 XX DT 29-November-2004 (last modified) kehi XX DE "Endosperm motif (EM)" found in the promoter of barley (H.v.) DE c-hordein gene; Involved in the nitrogen response of c-hordein DE promoter; XX KW EM; endosperm; hordein; nitrogen; XX OS Hordeum vulgare (barley) XX RA Muller M, Knudsen S. RT The nitrogen response of a barley C-hordein promoter is RT controlled by positive and negative regulation of the GCN4 and RT endosperm box. RL Plant J. 4: 343-355 (1993). RD PubMed: 8220485 XX SQ TGTAAAGT // ID EREGCC XX AC S000036 XX DT 03-Jun-2003 (last modified) kehi XX DE "GCC box" in "ERE (ethylene responsive element)"; DE Ethylene-responsive region of tobacco (N.t.) chitinase gene DE contains two copies of the GCC-box; ERF2 and ERF4 enhanced the DE GCC box-mediated transcription; ERF3 reduced the transcription of DE the reporter gene in tobacco protoplasts; Binding site of AtEBP; DE Pti4/5/6 proteins from tomato which belong to the ERF family DE activate the expression of "GCC box"-containing PR genes; ERF3 DE was found to interact with NtUBC2, a ubiquitin-conjugating DE enzyme; XX KW Ethylene; EREBP; GCC box; G-box; CHN; ERE; ERF; xylanase; TvX; KW OBF; bZIP; EBP; pathogen; ocs; leaf; shoot; Pti4/5/6; ubiquitin; KW UBC2; XX OS tobacco (Nicotiana tabacum); Arabidopsis thaliana; XX RA Koyama T, Okada T, Kitajima S, Ohme-Takagi M, Shinshi H, Sato F. RT Isolation of tobacco ubiquitin-conjugating enzyme cDNA in a yeast RT two-hybrid system with tobacco ERF3 as bait and its RT characterization of specific interaction. RL J Exp Bot. 54: 1175-1181 (2003) RD PubMed: 12654868; XX RA Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han RA Y, Martin GB RT Tomato transcription factors pti4, pti5, and pti6 activate RT defense responses when expressed in Arabidopsis RL Plant Cell 14: 817-831 (2002) RD PubMed: 11971137; XX RA Yamamoto S, Suzuki K, Shinshi H RT Elicitor-responsive, ethylene-independent activation of GCC RT box-mediated transcription that is regulated by both protein RT phosphorylation and dephosphorylaton in cultured tobacco cells RL Plant J 20: 571-579 (1999) RD PubMed: 10652129; XX RA Ohta M, Ohme-Takagi M, Shinshi H RT Three ethylene-responsive transcription factors in tobacco with RT distinct transactivation functions RL Plant J 22:29-38 (2000) RD PubMed: 10792818; XX RA Ohme-Takagi M, Shinshi H RT Ethylene-inducible DNA binding proteins that interact with an RT ethylene-responsive element RL Plant Cell 7: 173-182 (1995) RD PubMed: 7756828; XX RA Buttner M, Singh KB RT Arabidopsis thaliana ethylene-responsive element binding protein RT (AtEBP), an ethylene-inducible, GCC box DNA-binding protein RT interacts with an ocs element binding protein RL Proc Natl Acad Sci USA 94: 5961-5966 (1997) RD PubMed: 9159183; GenBank: Y09942; XX RA Ohme-Takagi M, Suzuki K, Shinshi H RT Regulation of Ethylene-Induced Transcription of Defense Genes RL Plant Cell Physiol 41: 1187-1192 (2000) RD PubMed: 11092902; XX SQ TAAGAGCCGCC // ID ERELEE4 XX AC S000037 XX DT 02-August-2006 (last modified) kehi XX DE "ERE (ethylene responsive element)" of tomato (L.e.) E4 and DE carnation GST1 genes; GST1 is related to senescence; Found in the DE 5'-LTR region of TLC1.1 retrotransposon family in Lycopersicon DE chilense (Tapia et al.); ERE motifs mediate ethylene-induced DE activation of the U3 promoter region; XX KW Ethylene; E4; GST1; senescence; ERE; fruit; XX OS tomato (Lycopersicon esculentum); carnation (Dianthus OS caryophyllus); Lycopersicon chilense; XX RA Itzhaki H, Maxson JM, Woodson WR RT An ethylene-responsive enhancer element is involved in the RT senescence-related expression of the carnation RT glutathione-S-transferase (GSTI) gene. RL Proc Natl Acad Sci USA 91:8925-8929 (1994) RD PubMed: 8090746; XX RA Montgomery J, Goldman S, Deikman J, Margossian L, Fischer RL RT Identification of an ethylene-responsive region in the promoter RT of a fruit ripening gene. RL Proc Natl Acad Sci USA 90:5939-5943 (1993) RD PubMed: 8327464; XX RA Tapia G, Verdugo I, Yanez M, Ahumada I, Theoduloz C, Cordero C, RA Poblete F, Gonzalez E, Ruiz-Lara S. RT Involvement of Ethylene in Stress-Induced Expression of the RT TLC1.1 Retrotransposon from Lycopersicon chilense Dun. RL Plant Physiol. 138:2075-2086 (2005) RD PubMed: 16040666 XX RA Rawat R, Xu ZF, Yao KM, Chye ML. RT Identification of cis-elements for ethylene and circadian RT regulation of the Solanum melongena gene encoding cysteine RT proteinase. RL Plant Mol Biol. 57: 629-643 (2005). RD PubMed: 15988560 XX SQ AWTTCAAA // ID ESPASGL01 XX AC S000509 XX DT 04-January-2007 (last modified) kehi XX DE "ESP (endosperm specificity palindrome)" element found in the DE promoter of oat (A.s.) globulin gene (AsGlo1); XX KW endosperm; globulin; XX OS Avena sativa (oat) XX RA Vickers CE, Xue G, Gresshoff PM. RT A novel cis-acting element, ESP, contributes to high-level RT endosperm-specific expression in an oat globulin promoter. RL Plant Mol Biol. 62:195-214 (2006) RD PubMed: 16915522 XX SQ ACATGTCATCATGT // ID EVENINGAT XX AC S000385 XX DT 26-October-2005 (last modified) kehi XX DE "Evening element" found 46 times in the promoters of 31 cycling DE genes in Arabidopsis thaliana (Harmer et al. 2000); Required for DE circadian control of gene expression; "EE (evening element) DE motif"; Also found in the promoter of the Solanum melongena gene DE encoding cysteine protease, and identified as cis-element for its DE circadian regulation (Rawat et al. 2005); XX KW evening; circadian; clock; EE; XX OS Arabidopsis thaliana; Solanum melongena; XX RA Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang RA X, Kreps JA, Kay SA RT Orchestrated transcription of key pathways in Arabidopsis by the RT circadian clock RL Science 290: 2110-2113 (2000) RD PubMed: 11118138; XX RA Rawat R, Xu ZF, Yao KM, Chye ML. RT Identification of cis-elements for ethylene and circadian RT regulation of the Solanum melongena gene encoding cysteine RT proteinase. RL Plant Mol Biol. 57: 629-643 (2005). RD PubMed: 15988560 XX SQ AAAATATCT // ID GADOWNAT XX AC S000438 XX DT 01-August-2006 (last modified) kehi XX DE Sequence present in 24 genes in the GA-down regulated d1 cluster DE (106 genes) found in Arabidopsis seed germination; This motif is DE similar to ABRE (Busk and Pages 1998); XX KW Ga; seed; germaination; XX OS Arabidopsis thaliana; XX RA Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi RA S. RT Gibberellin biosynthesis and response during Arabidopsis seed RT germination. RL Plant Cell 15: 1591-1604 (2003) RD PubMed: 12837949; XX RA Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, RA Shinozaki K, Yamaguchi-Shinozaki K. RT Transcriptional regulation of ABI3- and ABA-responsive genes RT including RD29B and RD29A in seeds, germinating embryos, and RT seedlings of Arabidopsis. RL Plant Mol Biol. 60: 51-68 (2006). RD PubMed: 16463099 XX SQ ACGTGTC // ID GAGA8HVBKN3 XX AC S000427 XX DT 29-Sep-2003 (last modified) kehi XX DE "GA octodinucleotide repeat" found in intron IV of the barley DE (H.v.) gene Bkn3; Binding site for GAGA-binding factor BBR; See DE S000405 (GAGA element in the soy bean Gsa1 gene); XX KW GAGA; GBP; BBR; XX OS Hordeum vulgare (barley) XX RA Santi L, Wang Y, Stile MR, Berendzen K, Wanke D, Roig C, Pozzi C, RA Muller K, Muller J, Rohde W, Salamini F. RT The GA octodinucleotide repeat binding factor BBR participates in RT the transcriptional regulation of the homeobox gene Bkn3. RL Plant J. 34:813-826 (2003) RD PubMed: 12795701; XX SQ GAGAGAGAGAGAGAGA // ID GAGAGMGSA1 XX AC S000405 XX DT 21-Nov-2002 (last modified) uchi XX DE "GAGA element" found in the promoter of the heme and chlorophyll DE synthesis gene Gsa1 in soybean (G.m.); GAGA binding protein (GBP) DE binds to (GA)n/(CT)n DNA; XX KW Dinucleotide repeat; GAGA element; GBP; Gsa1; XX OS Glycine max (soybean) XX RA Sangwan I, O'Brian MR RT Identification of a Soybean Protein That Interacts with GAGA RT Element Dinucleotide Repeat DNA RL Plant Physiol. 129: 1788-1794 (2002) RD PubMed: 12177492; XX SQ GAGAGAGAGAGAGAGAGA // ID GARE1OSREP1 XX AC S000419 XX DT 28-November-2004 (last modified) kehi XX DE "Gibberellin-responsive element (GARE)" found in the promoter DE region of a cystein proteinase (REP-1) gene in rice; See DE S000020; XX KW aleurone; GARE; gibberellin; seed; XX OS Oryza sativa (rice) XX RA Sutoh K, Yamauchi D. RT Two cis-acting elements necessary and sufficient for RT gibberellin-upregulated proteinase expression in rice seeds RL Plant J. 34: 636-645 (2003) RD PubMed: 12787245; XX SQ TAACAGA // ID GARE2 XX AC S000165 XX DT 17-May-1998 (last modified) kehi XX DE Putative gibberellin responsive element; Consensus sequence of GA DE inducible alpha-amylase genes from rice, barley and wheat; XX KW gibberellin; GARE; seed; XX OS rice (Oryza sativa); barley (Hordeum vulgare); wheat (Triticum OS aestivum); XX RA Huang N, Sutliff TD, Litts JC, Rodriguez RL RT Classification and characterization of the rice alpha-amylase RT multigene family. RL Plant Mol Biol 14:655-668 (1990) RC Consensus sequence of GA-induced genes RD PubMed: 2102847; GenBank: X16509; XX RA Rogers JC, Rogers SW RT Definition and functional implications of gibberellin and RT abscisic acid cis-acting hormone response complexes RL Plant Cell 4:1443-1451 (1992) RD PubMed: 1477557; XX SQ RTAACARANTCYGG // ID GARE2OSREP1 XX AC S000420 XX DT 28-November-2004 (last modified) kehi XX DE "Gibberellin-responsive element (GARE)" found in the promoter DE region of a cystein proteinase (REP-1) gene in rice; See DE S000020; XX KW aleurone; GARE; gibberellin; seed; XX OS Oryza sativa (rice) XX RA Sutoh K, Yamauchi D. RT Two cis-acting elements necessary and sufficient for RT gibberellin-upregulated proteinase expression in rice seeds RL Plant J. 34: 636-645 (2003) RD PubMed: 12787245; XX SQ TAACGTA // ID GARE4HVEPB1 XX AC S000297 XX DT 10-Feb-2000 (last modified) seki XX DE "GARE-4" found in the barley (H.v.) EPB-1 (cysteine proteinase) DE gene promoter; Located between -142 to -156; Required for GA DE induction; Putative binding site of transcription factor, GAMyB; DE See S000298; XX KW EPB; cysteine proteinase; GA; ABA; GARE; pyrimidine box; seed; KW aleurone; XX OS barley (Hordeum vulgare) XX RA Cercos M, Gomez-Cadenas A, Ho THD RT Hormonal regulation of a cysteine proteinase gene, EPB-1, in RT barley aleurone layers: cis- and trans-acting elements involved RT in the co-ordinated gene expression regulated by gibberellins and RT abscisic acid RL Plant J 19: 107-118 (1999) RD PubMed: 10476058 XX SQ GTAACAGAATGCTGG // ID GAREAT XX AC S000439 XX DT 27-Jan-2004 (last modified) kehi XX DE GARE (GA-responsive element); Occurrence of GARE in GA-inducible, DE GA-responsible, and GA-nonresponsive genes found in Arabidopsis DE seed germination was 20, 18, and 12%, respectively; see S000181; XX KW GARE; GA; XX OS Arabidopsis thaliana; XX RA Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi RA S. RT Gibberellin biosynthesis and response during Arabidopsis seed RT germination. RL Plant Cell 15: 1591-1604 (2003) RD PubMed: 12837949; XX SQ TAACAAR // ID GAREHVAMY1 XX AC S000038 XX DT 17-May-1998 (last modified) kehi XX DE "GARE (gibberellic acid responsive element)" of barley (H.v.) DE alpha-amylase gene (Amy 1/6-4); GA3; XX KW gibberellic acid; GA; GA3; amylase; Amy1/6-4; GARE; XX OS barley (Hordeum vulgare) XX RA Skriver K, Olsen FL, Rogers JC, Mundy J RT Cis-acting DNA elements responsive to gibberellin and its RT antagonist abscisic acid. RL Proc Natl Acad Sci USA 88:7266-7270 (1991) RD PubMed: 1831269; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX SQ GGCCGATAACAAACTCCGGCC // ID GATABOX XX AC S000039 XX DT 01-August-2006 (last modified) kehi XX DE "GATA box"; GATA motif in CaMV 35S promoter; Binding with ASF-2; DE Three GATA box repeats were found in the promoter of Petunia DE (P.h.) chlorophyll a/b binding protein, Cab22 gene; Required for DE high level, light regulated, and tissue specific expression; DE Conserved in the promoter of all LHCII type I Cab genes; XX KW ASF-2; GATA box; Cab; chlorophyll a/b binding protein; leaf; KW shoot; XX OS CaMV; Cauliflower mosaic virus; Petunia hybrida (petunia); OS Arabidopsis thaliana; Oryza sativa (rice); XX RA Lam E, Chua NH RT ASF-2: A factor that binds to the cauliflower mosaic virus 35S RT promoter and a conserved GATA motif in cab promoters. RL Plant Cell 1:1147-1156 (1989) RD PubMed: 2535536; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Benfey PN, Chua NH RT The cauliflower mosaic virus 35S promoter: combinatorial RT regulation of transcription in plants RL Science 250:959-966 (1990) XX RA Gidoni D, Brosio P, Bond-Nutter D, Bedbrook J, Dunsmuir P RT Novel cis-acting elements in Petunia Cab gene promoters RL Mol Gen Genet 215: 337-344 (1989) RD PubMed: 2651885; XX RA Teakle GR, Manfield IW, Graham JF, Gilmartin PM RT Arabidopsis thaliana GATA factors: organisation, expression and RT DNA-binding characteristics RL Plant Mol Biol. 50 :43-57 (2002) RD PubMed: 12139008; XX RA Reyes JC, Muro-Pastor MI, Florencio FJ. RT The GATA family of transcription factors in Arabidopsis and RT rice. RL Plant Physiol. 134: 1718-1732 (2004). RD PubMed: 15084732 XX RA Rubio-Somoza I, Martinez M, Abraham Z, Diaz I, Carbonero P. RT Ternary complex formation between HvMYBS3 and other factors RT involved in transcriptional control in barley seeds. RL Plant J. 47: 269-281 (2006) RD PubMed: 16762033 XX SQ GATA // ID GBOX10NT XX AC S000272 XX DT 15-Oct-1999 (last modified) kehi XX DE One of 11 G-box sequences in tobacco (N.t.); Required for DE high-level constitutive expression in seed, leaf, root, axillary DE bud, almost all parts of flower buds and pollen; XX KW G-box; G-box 10; tetramer; seed; root; leaf; axillary bud; KW pollen; XX OS tobacco (Nicotiana tabacum) XX RA Ishige F, Takaichi M, Foster R, Chua NH, Oeda K RT A G-box motif (GCCACGTGCC) tetramer confers high-level RT constitutive expression in dicot and monocot plants RL Plant J 18:443-448 (1999) XX SQ GCCACGTGCC // ID GBOXLERBCS XX AC S000041 XX DT 7-Sep-2000 (last modified) seki XX DE "G box"; Conserved sequence upstream of light-regulated genes; DE Sequence found in the promoter region of rbcS of tomato (L.e.) DE and Arabidopsis; Binding with GBF; M=A/C; See S000345; XX KW G box; rbcS; tomato; G-box; leaf; shoot; XX OS tomato (Lycopersicon esculentum); Arabidopsis thaliana; XX RA Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore RA AR RT An evolutionarily conserved protein binding sequence upstream of RT a plant light-regulated gene. RL Proc Natl Acad Sci USA 85:7089-7093 (1988) RD PubMed: 2902624; XX RA Donald RGK, Cashmore AR RT Mutation of either G box or I box sequences profoundly affects RT expression from the Arabidopsis rbcS-1A promoter. RL EMBO J 9:1717-1726 (1990) RD PubMed: 2347304; XX RA Vasil V, Marcotte Jr. WR, Rosenkrans L, Cocciolone SM, Vasil IK, RA Quatrano RS, McCarty DR RT Overlap of viviparous1 (VP1) and abscisic acid response elements RT in the EM promoter: G-Box elements are sufficient but not RT necessary for VP1 transactivation RL Plant Cell 7: 1511-1518 (1995) RD PubMed: 8589631 XX SQ MCACGTGGC // ID GBOXPC XX AC S000324 XX DT 7-Sep-2000 (last modified) seki XX DE "G box"; Binding site of parsley (P.c.) cytosolic G-box binding DE factors (cytosolic GBFs); Cytosolic G-Box binding activity is DE modulated by light; DNA binding activity of cytosolic GBFs is DE regulated by cytosolic phosphorylation/dephospholylation DE activities; Cytosolic GBFs are translocated to the nucleus in a DE light-regulated manner; XX KW G-box; light; cytosolic GBFs; bZIP; leaf; shoot; XX OS parsley (Petroselinum crispum) XX RA Harter K, Kircher S, Frohnmeyer H, Krenz M, Nagy F, Schafer E RT Light-regulated modification and nuclear translocation of RT cytosolic G-box binding factors in parsley RL Plant Cell 6: 545-559 (1994) RD PubMed: 8205004; XX SQ ACCACGTGGC // ID GBOXRELOSAMY3 XX AC S000206 XX DT 29-Sep-1999 (last modified) kehi XX DE G box-related element found in Amy3D (amylase) promoter of rice DE (O.s.); Similar to ABRE; XX KW amylase; G box; G box-like element; XX OS rice (Oryza sativa); XX RA Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL RT Three cis-elements required for rice alpha-amylase Amy3D RT expression during sugar starvation RL Plant Mol Biol 36:331-341 (1998) RD PubMed: 9484474; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CTACGTGGCCA // ID GBOXSORBCS1 XX AC S000380 XX DT 23-Aug-2001 (last modified) uchi XX DE "G-box" found in the spinach(S.O.) RBCS-1 gene promoter; Located DE between -219 and -212; G-box trimer confers relatively high level DE expression in roots; XX KW RBCS-1; G-box; root; XX OS spinach (Spinacia oleracea) XX RA Lubberstedt T, Bolle CE, Sopory S, Flieger K, Herrmann RG, RA Oelmuller R RT Promoters from genes for plastid proteins possess regions with RT different sensitivities toward red and blue light RL Plant Physiol 104: 997-1006 (1994) RD PubMed: 8165263; XX SQ TCCACGTGGT // ID GCAACREPEATZMZEIN XX AC S000027 XX DT 17-May-1998 (last modified) kehi XX DE "GCAAC repeat" found in the 22bp recognition site for beta-1 DE factor in the promoter of beta-zein (prolamin type) gene of maize DE (Z.m.); GCAAC is the core recognition sequence of the protein DE encoded by the retroviral oncogene myb (Biedenkapp et al. Nature DE 335:835-837 (1988)); XX KW beta-zein; GCAAC; repeat; myb; seed; endosperm; XX OS maize (Zea mays) XX RA So J-S, Larkins BA RT Binding of an endosperm-specific nuclear protein to a maize RT beta-zein gene correlates with zein transcriptional activity RL Plant Mol Biol 17:309-319 (1991) RD PubMed: 1883992; XX SQ GCAACGCAAC // ID GCBP2ZMGAPC4 XX AC S000351 XX DT 16-Feb-2001 (last modified) seki XX DE Binding site of tobacco nuclear factor (GCBP-2) found in the DE maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) DE gene promoter; Located between -293 and -285; See S000350; XX KW anaerobic; GapC4; GCBP-2; XX OS maize (Zea mays) XX RA Geffers R, Cerff R, Hehl R RT Anaerobiosis-specific interaction of tobacco nuclear factors with RT cis-regulatory sequences in the maize GapC4 promoter RL Plant Mol Biol 43: 11-21 (2000) RD PubMed: 10949370; XX SQ GTGGGCCCG // ID GCCCORE XX AC S000430 XX DT 28-Jan-2004 (last modified) kehi XX DE Core of GCC-box found in many pathogen-responsive genes such as DE PDF1.2, Thi2.1, and PR4; Has been shown to function as DE ethylene-responsive element; See S000036, S000232, S000332; DE Appears to play important roles in regulating DE jasmonate-responsive gene expression; Tomato Pti4 (ERF) regulates DE defence-related gene expression via GCC box and non-GCC box cis DE elements (Myb1 (GTTAGTT) and G-box(CACGTG)); XX KW GCC; GCC-box; ERE; JA; Pti4; ERF; PR; XX OS Arabidopsis thaliana; Lycopersicon esculentum (tomato); XX RA Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM. RT A role for the GCC-box in jasmonate-mediated activation of the RT PDF1.2 gene of Arabidopsis. RL Plant Physiol. 132:1020-1032 (2003) RD PubMed: 12805630; XX RA Chakravarthy S, Tuori RP, DAscenzo MD, Fobert PR, Despres C, RA Martin GB RT The tomato transcription factor Pti4 regulates defence-related RT gene expression via GCC box and non-GCC box cis elements RL Plant Cell 15: 3033-3050 (2003) RD PubMed: 14630974; XX SQ GCCGCC // ID GCN4OSGLUB1 XX AC S000277 XX DT 21-May-2002 (last modified) uchi XX DE "GCN4 motif" found in GluB-1 gene in rice (O.s.); Required for DE endosperm-specific expression; See S000276; AACA and ACGT motifs DE was found sufficient to confer a detectable level of endosperm DE expression; See S000353, S000354; This motif is the recognition DE site for a basic leucine zipper transcription factor that belongs DE to the group of maize Opaque-2 (O2)-like proteins; Although all DE the RISBZ proteins are able to interact with the GCN4 motif, only DE RISBZ1 is capable of activating the gene expression; XX KW GluB-1; glutelin; endosperm; seed; storage protein; GCN4 motif; KW RISBZ proteins; O2; XX OS rice (Oryza sativa) XX RA Washida H, Wu CY, Suzuki A, Yamanouchi U, Akihama T, Harada K, RA Takaiwa F RT Identification of cis-regulatory elements required for endosperm RT expression of the rice storage protein glutelin gene GluB-1 RL Plant Mol Biol 40:1-12 (1999) RD PubMed: 10394940; XX RA Wu C, Washida H, Onodera Y, Harada K, Takaiwa F RT Quantitative nature of the Prolamin-box, ACGT and AACA motifs in RT a rice glutelin gene promoter: minimal cis-element requirements RT for endosperm-specific gene expression RL Plant J 23: 415-421 (2000) RD PubMed: 10929134; XX RA Onodera Y, Suzuki A, Wu CY, Washida H, Takaiwa F RT A rice functional transcriptional activator, RISBZ1, responsible RT for endosperm-specific expression of storage protein genes RT through GCN4 motif RL J Biol Chem 27: 14139-14152 (2001) RD PubMed: 11133985; XX SQ TGAGTCA // ID GGTCCCATGMSAUR XX AC S000360 XX DT 16-Feb-2001 (last modified) seki XX DE Sequence found in NDE element in Soybean (G.m.) SAUR (Small DE Auxin-Up RNA) 15A gene promoter; Involved in auxin DE responsiveness; See S000270, S000359; XX KW SAUR; NDE; Auxin; XX OS Soybean (Glycine max) XX RA Xu N, Hagen G, Guilfoyle T RT Multiple auxin response modules in the soybean SAUR 15A promoter RL Plant Sci 126: 193-201 (1997) XX SQ GGTCCCAT // ID GLMHVCHORD XX AC S000451 XX DT 29-November-2004 (last modified) kehi XX DE "GLM (GCN4-like motif)" found in the promoter of barley (H.v.) DE B1- and c-hordein gene; Involved in the nitrogen response of DE c-hordein promoter; R=A/G; S=C/G; See also S000277 (GCN4OSGLUB1); DE SPA, a seed-specific basic leucine zipper protein from wheat, can DE activate transcription from the GCN4-like motif (GLM) of -326 DE LMWG-1D1 promoter (Albani et al., 1997); XX KW GLM; GCN4; hordein; GLM; XX OS Hordeum vulgare (barley); Triticum aestivum (wheat); XX RA Muller M, Knudsen S. RT The nitrogen response of a barley C-hordein promoter is RT controlled by positive and negative regulation of the GCN4 and RT endosperm box. RL Plant J. 4: 343-355 (1993). RD PubMed: 8220485 XX RA Albani D, Hammond-Kosack MC, Smith C, Conlan S, Colot V, RA Holdsworth M, Bevan MW. RT The wheat transcriptional activator SPA: a seed-specific bZIP RT protein that recognizes the GCN4-like motif in the bifactorial RT endosperm box of prolamin genes. RL Plant Cell. 9: 171-184 (1997). RD PubMed: 9061949 XX RA Onate L, Vicente-Carbajosa J, Lara P, Diaz I, Carbonero P. RT Barley BLZ2, a seed-specific bZIP protein that interacts with RT BLZ1 in vivo and activates transcription from the GCN4-like motif RT of B-hordein promoters in barley endosperm. RL J Biol Chem. 274: 9175-9182 (1999). RD PubMed: 10092589 XX SQ RTGASTCAT // ID GLUTAACAOS XX AC S000045 XX DT 17-May-1998 (last modified) kehi XX DE "glutelin common motif"; "AACA motif"; Conserved in all member of DE rice (0.s.) glutelin; -74 to -64; XX KW AACA; glutelin; seed; endosperm; XX OS rice (Oryza sativa) XX RA Takaiwa F, Oono K RT Interaction of an immature seed-specific trans-acting factor with RT the 5' upstream region of a rice glutelin gene. RL Mol Gen Genet 224:289-293 (1990) RD PubMed: 2277646; XX SQ AACAAACTCTAT // ID GLUTEBOX1OSGT2 XX AC S000046 XX DT 17-May-1998 (last modified) kehi XX DE "Box 1" of rice (O.s.) glutelin Gt2 gene family promoter regions; DE nuclear factor binding site; XX KW glutelin; Box 1; Gt2; seed; endosperm; XX OS rice (Oryza sativa) XX RA Kim SY, Wu R RT Multiple protein factors bind to a rice glutelin promoter RT region. RL Nucleic Acids Res 18:6845-6852 (1990) RD PubMed: 2263449; GenBank: X52153; XX SQ ATATCATGAGTCACTTCA // ID GLUTEBOX1OSGT3 XX AC S000128 XX DT 17-May-1998 (last modified) kehi XX DE "Box 1" of rice (O.s.) glutelin Gt3 gene family promoter region; DE See S000128 GLUTEBOX2A; XX KW Box 1; glutelin; Gt3; seed; endosperm; XX OS rice (Oryza sativa); XX RA Croissant-Sych Y, Okita TW RT Identification of positive and negative regulatory cis-elements RT of the rice glutelin Gt3 promoter. RL Plant Science 116:27-35 (1996) XX SQ TATCTAGTGAGTCACTTCA // ID GLUTEBOX2OSGT2 XX AC S000047 XX DT 17-May-1998 (last modified) kehi XX DE "Box II" of rice (O.s.) glutelin Gt2 gene family; nuclear factor DE binding site; XX KW glutelin; Box II; Gt2; seed; endosperm; XX OS rice (Oryza sativa) XX RA Kim SY, Wu R RT Multiple protein factors bind to a rice glutelin promoter RT region. RL Nucleic Acids Res 18:6845-6852 (1990) RD PubMed: 2263449; GenBank: X52153; XX SQ TCCGTGTACCA // ID GLUTEBOX2OSGT3 XX AC S000129 XX DT 17-May-1998 (last modified) kehi XX DE "Box 2" of rice (O.s.) glutelin Gt3 gene family promoter region; DE See S000128 GLUTEBOX1A; XX KW Box 2; glutelin; Gt3; seed; endosperm; XX OS rice (Oryza sativa); XX RA Croissant-Sych Y, Okita TW. RT Identification of positive and negative regulatory cis-elements RT of the rice glutelin Gt3 promoter. RL Plant Science 116:27-35 (1996) XX SQ CTTTTGTGTACCTTA // ID GLUTEBP1OS XX AC S000048 XX DT 17-May-1998 (last modified) kehi XX DE "Glutelin BP-1"; Binding site in the promoter region of glutelin DE Gt3 gene family of nuclear factor (PB-1); PB-1 is observed only DE in nuclear extract of developing seeds; XX KW glutelin; nuclear factor; seed; endosperm; BP-1; PB-1; XX OS rice (Oryza sativa) XX RA Zhao, Okita RL (in press; cited by Croissant-Sych Y, Okita TW, 1996) XX RA Croissant-Sych Y, Okita TW. RT Identification of positive and negative regulatory cis-elements RT of the rice glutelin Gt3 promoter. RL Plant Science 116:27-35 (1996) XX SQ AAGCAACACACAAC // ID GLUTEBP2OS XX AC S000049 XX DT 17-May-1998 (last modified) kehi XX DE "Glutelin BP-2"; Binding with nuclear factors from developing DE seeds; XX KW glutelin; nuclear factor; seed; endosperm; Gt3 gene family; XX OS rice (Oryza sativa) XX RA Zhao, Okita RL (in press; cited by Croissant-Sych Y, Okita TW, 1996) XX RA Croissant-Sych Y, Okita TW. RT Identification of positive and negative regulatory cis-elements RT of the rice glutelin Gt3 promoter. RL Plant Science 116:27-35 (1996) XX SQ ATGCTCAATAGATATAAGT // ID GLUTECOREOS XX AC S000050 XX DT 17-May-1998 (last modified) kehi XX DE Core site required for binding of the trans-acting factor in the DE promoter region of rice (O.s.) glutelin (type 2 glutelin gene DE family); XX KW rice; glutelin; type 2 glutelin; seed; endosperm; XX OS rice (Oryza sativa) XX RA Takaiwa F, Oono K RT Interaction of an immature seed-specific trans-acting factor with RT the 5' upstream region of a rice glutelin gene. RL Mol Gen Genet 224:289-293 (1990) RD PubMed: 2277646; XX SQ CTTTCGTGTAC // ID GMHDLGMVSPB XX AC S000372 XX DT 31-Jul-2001 (last modified) uchi XX DE Binding site of the soybean homeodomein leucine zipper proteins DE (GmHdl56, GmHdl57); Found in the phosphate response domain of the DE soybean VspB promoter; Located between -536 and -527; VspB DE encodes vacuolar glycoprotein acid phosphatase that serve as DE vegetative storage protein; XX KW VspB; HD-ZIPS; phosphate response; homeotic domain; XX OS soybean (Glycine max) XX RA Tang Z, Sadka A, Morishige DT, Mullet JE RT Homeodomain leucine zipper proteins bind to the phosphate RT response domain of the soybean VspB tripartite promoter RL Plant Physiol 125: 797-809 (2001) RD PubMed: 11161037; XX SQ CATTAATTAG // ID GRAZMRAB17 XX AC S000150 XX DT 29-Sep-1999 (last modified) kehi XX DE "GRA"; GC-rich rab activator; Found in the promoter of ABA DE responsive rab17 gene from maize (Z.m.); Important for DE transcription in leaves but not in embryos; See S000200, S000401 DE and S000402; XX KW GRA; ABA; rab17; rab; leaf; embryo; seed; XX OS maize (Zea mays) XX RA Busk PK, Jensen AB, Pages M RT Regulatory elements in vivo in the promoter of the abscisic acid RT responsive gene rab17 from maize. RL Plant J 11:1258-1295 (1997) RD PubMed: 9225468; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CACTGGCCGCCC // ID GRAZMRAB28 XX AC S000220 XX DT 11-May-2006 (last modified) kehi XX DE "GRA"; "GC-rich rab activator"; Found in the promoter of ABA DE responsive rab28 gene from maize (Z.m.); Similar (seven of 12 DE bases) to the GRA element from the maize rab17 promoter (S000150; DE GRAZMRAB17); Found at -138 to -130; XX KW GRA; ABA; rab28; rab; seed; XX OS maize (Zea mays) XX RA Busk PK, Pages M RT Protein binding to the abscisic acid-responsive element is RT independent of VIVIPAROUS1 in vivo RL Plant Cell 9:2261-2270 (1997) RD PubMed: 11407411 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CATGCCGCC // ID GREGIONNTPRB1B XX AC S000364 XX DT 16-Feb-2001 (last modified) seki XX DE "G region" found in tobacco (N.t.) PRB-1b gene promoter; Located DE at -201 to -178; Binding site of nuclear protein; Required for DE ethylene induction; Contains an 11bp sequence, TAAGAGCCGCC, which DE is highly conserved in the promoter of ethylene-induced PR genes; DE Contains a G box motif; See S000365; XX KW PR-1; PRB-1b; ethylene; G; G box; XX OS Tobacco (Nicotiana tabacum) XX RA Meller Y, Sessa G, Eyal Y, Fluhr R RT DNA-protein interactions on a cis-DNA element essential for RT ethylene regulation RL Plant Mol Biol 23: 453-463 (1993) RD PubMed: 8219081; XX SQ TGGCGGCTCTTATCTCACGTGATG // ID GT1CONSENSUS XX AC S000198 XX DT 11-May-2006 (last modified) kehi XX DE Consensus GT-1 binding site in many light-regulated genes, e.g., DE RBCS from many species, PHYA from oat and rice, spinach RCA and DE PETA, and bean CHS15; R=A/G; W=A/T; For a compilation of related DE GT elements and factors, see Villain et al. (1996); GT-1 can DE stabilize the TFIIA-TBP-DNA (TATA box) complex; The activation DE mechanism of GT-1 may be achieved through direct interaction DE between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a DE promoter influences the level of SA-inducible gene expression; XX KW GT-1; light; TATA; TFIIA; TBP; HR; SAR; TMV; leaf; shoot; XX OS pea (Pisum sativum); oat (Avena sativa); rice (Oryza sativa); OS tobacco (Nicotiana tabacum); Arabidopsis thaliana; spinach OS (Spinacia oleracea); bean; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Le Gourrierec J, Li YF, Zhou DX RT Transcriptional activation by Arabidopsis GT-1 may be through RT interaction with TFIIA-TBP-TATA complex RL Plant J 18:663-668 (1999) RD PubMed: 10417717 XX RA Buchel AS, Brederode FT, Bol JF, Linthorst HJM RT Mutation of GT-1 binding sites in the Pr-1A promoter influences RT the level of inducible gene expression in vivo RL Plant Mol Biol 40:387-396 (1999) RD PubMed: 10437823; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ GRWAAW // ID GT1CORE XX AC S000125 XX DT 15-Oct-1999 (last modified) kehi XX DE Critical for GT-1 binding to box II of rbcS; See S000051 DE GT1MOTIF1; For a compilation of related GT elements and factors, DE see Villain et al. (1996); XX KW rbcS; box II; GT-1; rbcS-3; leaf; shoot; XX OS pea (Pisum sativum); XX RA Green PJ, Yong M-H, Cuozzo M, Kano-Murakami Y, Silverstein P, RA Chua N-H RT Binding site requirements for pea nuclear protein factor GT-1 RT correlate with sequences required for light-dependent RT transcriptional activation of the rbcS-3A gene. RL EMBO J 7:4035-4044 (1988) RD PubMed: 3243271; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review XX SQ GGTTAA // ID GT1GMSCAM4 XX AC S000453 XX DT 29-November-2004 (last modified) kehi XX DE "GT-1 motif" found in the promoter of soybean (Glycine max) CaM DE isoform, SCaM-4; Plays a role in pathogen- and salt-induced DE SCaM-4 gene expression; See also S000198 (GT-1 consensus); XX KW GT-1 box; XX OS Glycine max (soybean) XX RA Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong RA JC, Moon BC, Lee JH, Yoon HW, Lee SH, Chung WS, Lim CO, Lee SY, RA Hong JC, Cho MJ. RT Pathogen- and NaCl-induced expression of the SCaM-4 promoter is RT mediated in part by a GT-1 box that interacts with a GT-1-like RT transcription factor. RL Plant Physiol. 135: 2150-2161 (2004). RD PubMed: 15310827 XX SQ GAAAAA // ID GT1MOTIFPSRBCS XX AC S000051 XX DT 15-Oct-1999 (last modified) kehi XX DE "GT-1 motif"; "Consensus sequence of rbcS BOX II, III, II', DE III'"; "GT-1 box"; 5' upstream region (-151) of pea (P.s.) rbcS DE gene; binding with trans factor GT-1; See S000125 GT1CORE; K=G/T; DE W=A/T; R=A/G; For a compilation of related GT elements and DE factors, see Villain et al. (1996); XX KW RBCS; BOX 2; Box II; GT-1; PEA; leaf; shoot; XX OS pea (Pisum sativum) XX RA Green PJ, Yong M-H, Cuozzo M, Kano-Murakami Y, Silverstein P, RA Chua N-H RT Binding site requirements for pea nuclear protein factor GT-1 RT correlate with sequences required for light-dependent RT transcriptional activation of the rbcS-3A gene. RL EMBO J 7:4035-4044 (1988) RD PubMed: 3243271; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review XX SQ KWGTGRWAAWRW // ID GT2OSPHYA XX AC S000207 XX DT 11-May-2006 (last modified) kehi XX DE GT-2 (a rice nuclear protein) binding site in a rice (O.s.) phyA DE promoter; phyA gene are transcriptionaly repressed in response to DE light; One of GT elements; For a compilation of related GT DE elements and factors, see Villain et al. (1996); The HMG-1/Y DE protein PF1 stimulates binding of the GT-2 to PHYA gene DE promoter; XX KW GT-2; phyA; GT; light; HMG-1/Y protein; PF1; leaf; shoot; XX OS rice (Oryza sativa); oat (Avena sativa); XX RA Dehesh K, Bruce WB, Quail PH RT A trans-acting factor that binds to a GT-motif in a phytochrome RT gene promoter RL Science 250:1397-1399 (1990) RD PubMed: 2255908; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Martinez-Garcia JF, Quail PH RT The HMG-I/Y protein PF1 stimulates binding of the transcriptional RT activator GT-2 to the PHYA gene promoter RL Plant J 18:173-183 (1999) RD PubMed: 10363369; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ GCGGTAATT // ID GTGANTG10 XX AC S000378 XX DT 23-Aug-2001 (last modified) uchi XX DE "GTGA motif" found in the promoter of the tobacco (N.t.) late DE pollen gene g10 which shows homology to pectate lyase and is the DE putative homologue of the tomato gene lat56; Located between -96 DE and -93; See S000280; XX KW g10; pollen; pectate lyase; XX OS tabacco(Nicotiana tabacum) XX RA Rogers HJ, Bate N, Combe J, Sullivan J, Sweetman J, Swan C, RA Lonsdale DM, Twell D RT Functional analysis of cis-regulatory elements within the RT promoter of the tobacco late pollen gene g10 RL Plant Mol Biol 45: 577-585 (2001) RD PubMed: 11414616; XX SQ GTGA // ID HBOXCONSENSUSPVCHS XX AC S000200 XX DT 27-Aug-2002 (last modified) uchi XX DE "H-box"; Consensus sequence of H-boxes found in bean (Phaseolus DE vulgaris) chs15 gene promoter; Essential for both light DE regulation and elicitor induction; Similar sequence was found in DE tobacco Tnt1 retrotransposon promoter (LTR); Tnt1 is induced by DE wounding and by abiotic stress; "KAP-2" binds to the H-box and DE stimulates transcription from a promoter harboring the H-box; DE "KAP-2" shares sequence similarity to the large subunit of DE mammalian Ku autoantigen; See S000150, S000402 and S000401; XX KW H-box; H box; CHS; chs; light regulation; light; elicitor; KW stress; transposon; wounding; leaf; shoot; Ku autoantigen; KW KAP-2; XX OS bean (Phaseolus vulgaris); tobacco; XX RA Loake GJ, Faktor O, Lamb CJ, Dixon RA RT Combination of H-box [CCTACC(N)7CT] and G-box (CACGTG) cis RT elements is necessary for feed-forward stimulation of a chalcone RT synthase promoter by the phenypropanoid-pathway intermediate RT p-coumaric acid RL Proc Natl Acad Sci USA 89:9230-9234(1992) RD PubMed: 1409628; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX RA Mhiri C, Morel JB, Vernhettes S, Casacuberta JM, Lucas H, RA Grandbastien MA RT The promoter of the tobacco Tnt1 retrotransposon is induced by RT wounding and by abiotic stress RL Plant Mol Biol 33:257-266 (1997) RD PubMed: 9037144; XX RA Lindsay WP, McAlister FM, Zhu Q, He XZ, Droge-Laser W, Hedrick S, RA Doerner P, Lamb C, Dixon RA RT KAP-2, a protein that binds to the H-box in a bean chalcone RT synthase promoter, is a novel plant transcription factor with RT sequence identity to the large subunit of human Ku autoantigen RL Plant Mol Biol 49: 503-514 (2002) RD PubMed: 12090626; XX SQ CCTACCNNNNNNNCT // ID HBOXPVCHS15 XX AC S000361 XX DT 16-Feb-2001 (last modified) seki XX DE Binding site of two bean protein factors, KAP-1 and KAP-2; KAP-1 DE is a 97 kDa polypeptide; KAP-2 comprises two polypeptides of 76 DE kDa and 56 kDa; Elicitation of bean cell with glutathione causes DE a rapid increase in specific activities of KAP-1 and KAP2; XX KW H-box; KAP-1; KAP-2; elicitor; glutathione; XX OS bean (Phaseolus vulgaris) XX RA Yu LM, Lamb CJ, Dixon RA RT Purification and biochemical characterization of proteins which RT bind to the H-box cis-element implicated in transcriptional RT activation of plant defense genes RL Plant J 3: 805-816 (1993) RD PubMed: 8401613; XX SQ CCTACCNNNNNNNCTNNNNA // ID HDMOTIFPCPR2 XX AC S000233 XX DT 17-May-1998 (last modified) kehi XX DE HD (homeodomain) protein target site in parsley (P.c.) DE pathogenesis-related protein 2 (PR2); A potential in vivo target DE site; XX KW HD; homeodomain; PR2; XX OS parsley (Petroselinum crispum) XX RA Korfhage U, Trezzini GF, Meier I, Hahlbrock K, Somssich IE RT Plant homeodomain protein involved in transcriptional regulation RT of a pathogen defense-related gene RL Plant Cell 6:695-708 (1994) RD PubMed: 7913642; XX SQ CTAATTGTTTA // ID HDZIP2ATATHB2 XX AC S000373 XX DT 31-Jul-2001 (last modified) uchi XX DE Binding site of the Arabidopsis (A.T.) homeobox gene (ATHB-2) DE found in its own promoter; Located between -72 and -80; Similar DE to the HD-ZIP-2 binding consensus sequence; ATHB-2 is regulated DE by light signals which function as a negative autoregulator of DE its own gene; M=C/A; XX KW ATHB-2; HAT4; HD-ZIP; shade avoidance responses; XX OS Arabidopsis thaliana XX RA Ohgishi M, Oka A, Morelli G, Ruberti I, Aoyama T RT Negative autoregulation of the Arabidopsis homeobox gene ATHB-2 RL Plant J 25: 389-398 (2001) RD PubMed: 11260495; XX SQ TAATMATTA // ID HDZIPIIIAT XX AC S000475 XX DT 05-November-2005 (last modified) kehi XX DE Ath b-9 HD-Zip (HD-Zip-9), a member of a small family of HD-Zip DE proteins (HD-ZIP III), in Arabidopsis recognize this sequence; DE See also S000371; S=G/C; XX KW Homeobox; HD-ZIP; XX OS Arabidopsis thaliana XX RA Sessa G, Steindler C, Morelli G, Ruberti I. RT The Arabidopsis Athb-8, -9 and -14 genes are members of a small RT gene family coding for highly related HD-ZIP proteins. RL Plant Mol Biol. 38: 609-622.(1998) RD PubMed: 9747806 XX RA Ohashi-Ito K, Kubo M, Demura T, Fukuda H. RT Class III Homeodomain Leucine-Zipper Proteins Regulate Xylem Cell RT Differentiation. RL Plant Cell Physiol. 46: 1646-1656 (2005) RD PubMed: 16081527 XX SQ GTAATSATTAC // ID HEXAMERATH4 XX AC S000146 XX DT 10-May-1998 (last modified) kehi XX DE hexamer motif of Arabidopsis thaliana (A.t.) histone H4 DE promoter; XX KW hexamer; histone; H4; meristem; XX OS Arabidopsis thaliana; XX RA Chaubet N, Flenet M, Clement B, Brignon P, Gigot C RT Identification of cis-elements regulating the expression of an RT Arabidopsis histone H4 gene. RL Plant J 10:425-435 (1996) RD PubMed: 8811858; XX SQ CCGTCG // ID HEXAT XX AC S000334 XX DT 7-Sep-2000 (last modified) seki XX DE "Hex motif"; Binding site of Arabidopsis (A.t.) bZIP protein TGA1 DE and G box binding factor GBF1; TGA1 and members of the GBF family DE differ in their DNA binding properties; G-Box-like element; XX KW TGA1; GBF; G-box; bZIP; Hex motif; XX OS Arabidopsis thaliana XX RA Schindler U, Beckmann H, Cashmore AR RT TGA1 and G-box binding factors: two distinct classes of RT Arabidopsis leucine zipper proteins compete for the G-box-like RT element TGACGTGG RL Plant Cell 4: 1309-1319 (1992) RD PubMed: 1446171; GenBank: X68053 XX SQ TGACGTGG // ID HEXMOTIFTAH3H4 XX AC S000053 XX DT 11-May-2006 (last modified) kehi XX DE "hexamer motif" found in promoter of wheat (T.a.) histone genes DE H3 and H4; CaMV35S; NOS; Binding with HBP-1A and HBP-1B; Binding DE site of wheat (T.a.) nuclear protein HBP-1 (histone DNA binding DE protein-1); HBP-1 has a leucine zipper motif; "hexamer motif" in DE type 1 element may play important roles in regulation of DE replication- dependent but not of replication-independent DE expression of the wheat histone H3 gene; See S000076, S000267; DE Rice OBF1-homodimer-binding site (Shimizu et al.); XX KW hexamer; HBP-1A; HBP-1B; histone H3; CaMV; 35S; NOS; HBP-1; KW Leucine zipper motif; meristem; OBF1; bZIP; lip19; LIP19; XX OS wheat (Triticum aestivum); CaMV; Oryza sativa (rice); XX RA Mikami K, Tabata T, Kawata T, Nakayama T, Iwabuchi M RT Nuclear protein(s) binding to the conserved DNA hexameric RT sequence postulated to regulate transcription of wheat histone RT genes. RL FEBS Lett 223: 273-278 (1987) RD PubMed: 2822486; XX RA Mikami K, Nakayama T, Kawata T, Tabata T, Iwabuchi M RT Specific interaction of nuclear protein HBP-1 with the conserved RT hexameric sequence ACGTCA in the regulatory region of wheat RT histone genes. RL Plant Cell Physiol 30:107-119 (1989). RD PubMed: 2772648; XX RA Tabata T, Takase H, Takayama S, Mikami K, Nakatsuka A, Kawata T, RA Nakayama T, Iwabuchi M RT A protein that binds to a cis-acting element of wheat histone RT genes has a leucine zipper motif RL Science 245: 965-967 (1989) RD PubMed: 2772648 XX RA Terada R, Nakayama T, Iwabuchi M, Shimamoto K RT A type I element composed of the hexamer (ACGTCA) and octamer RT (CGCGGATC) motifs plays a role(s) in meristematic expression of a RT wheat histone H3 gene in transgenic rice plants RL Plant Mol Biol 27: 17-26 (1995) RD PubMed: 7865787 XX RA Shimizu H, Sato K, Berberich T, Miyazaki A, Ozaki R, Imai R, RA Kusano T. RT LIP19, a Basic Region Leucine Zipper Protein, is a Fos-like RT Molecular Switch in the Cold Signaling of Rice Plants. RL Plant Cell Physiol. 46 :1623-34. (2005) RD PubMed: 16051676 XX SQ ACGTCA // ID HSE XX AC S000054 XX DT 16-Feb-2001 (last modified) seki XX DE "HSE (heat shock response element)"; consensus sequence found in DE the promoter regions of heat shock protein genes; HSF binding DE site; HsfA3, a new member of the Hsf (heat stress transcription DE factor) family; was isolated by yeast two-hybrid screening, using DE HsfA1 as a bait; HsfA3 is a single copy gene with all conserved DE sequence elements characteristic of a heat stress transcription DE factor; XX KW heat shock; HSP; HSE; XX OS animal; plant; Drosophila; tomato (Lycopersicon peruvianum); XX RA Pelham H RT Activation of heat-shock genes in eukaryotes. RL Trends Genet 1:31-35 (1985) RC Review XX RA Bharti K, Schmidt E, Lyck R, Heerklotz D, Bublak D, Scharf KD RT Isolation and characterization of HsfA3, a new heat stress RT transcription factor of Lycopersicon peruvianum RL Plant J (2000) 22: 355-365 RD PubMed: 10849352; XX SQ CTNGAANNTTCNAG // ID HSELIKENTACIDICPR1 XX AC S000056 XX DT 17-May-1997 (last modified) kehi XX DE "HSE-like motif" in -56 region of acidic PR1 gene of tobacco DE (N.t.); not found in basic PR1 gene; XX KW tobacco; PR-protein; hse; XX OS tobacco (Nicotiana tabacum) XX RA Pfitzner UM, Pfitzner AJP, Goodman HM RT DNA sequence analysis of a PR-1a gene from tobacco: Molecular RT relationship of heat shock and pathogen responses in plants. RL Mol Gen Genet 211:290-295 (1988) XX SQ CNNGAANNNTTCNNG // ID HSELIKENTGLN2 XX AC S000057 XX DT 17-May-1998 (last modified) kehi XX DE "HSE-like sequence" in 5' upstream region of beta-1,3-glucanase DE gene (GLN2) of tobacco (N.t.); XX KW tobacco; beta-1,3-glucanase group 2; PR-protein; hse; promoter; KW heat shock; XX OS tobacco (Nicotiana tabacum) XX RA Ohme-Takagi M, Shinshi H RT Structure and expression of a tobacco beta-1,3-glucanase gene. RL Plant Mol Biol 15:941-946 (1990) RD PubMed: 2103484; GenBank: X53600; XX SQ AGGAATTCCT // ID HSRENTHSR203J XX AC S000466 XX DT 24-April-2005 (last modified) kehi XX DE "HSRE(HSR203 responsive element)" in tobacco (N.t.) responsible DE for the marked induction of the HSR203J gene during the HR DE (hypersensitive response); HSR203J is specifically activated DE during the early steps of incompatible plant/pathogen DE interactions; XX KW HR XX OS Nicotiana tabacum (tobacco) XX RA Pontier D, Balague C, Bezombes-Marion I, Tronchet M, Deslandes L, RA Roby D. RT Identification of a novel pathogen-responsive element in the RT promoter of the tobacco gene HSR203J, a molecular marker of the RT hypersensitive response. RL Plant J. 26: 495-507 (2001). RD PubMed: 11439136 XX SQ CAAAATTTTGTA // ID HY5AT XX AC S000345 XX DT 16-Feb-2001 (last modified) seki XX DE "G box"; Binding site of Arabidopsis bZIP protein HY5; HY5 is DE constitutively nuclear localized and is involved in light DE regulation of transcriptional activity of the promoters DE containing the G-box; See S000041, S000042, S000229; HY5 DE abundance peaks in early seedling development, consistent with DE its role in promoting photomorphogenesis; HY5 stability and DE activity is regulated by phosphorylation in its COP1 binding DE domain; HY5 regulates stimulus-induced development of root and DE hypocotyl; XX KW bZIP; HY5; LRE; G box; COP1; bZIP; stimulus-response; root; KW hypocotyl; leaf; shoot; XX OS Arabidopsis thaliana XX RA Chattopadhyay S, Ang LH, Puente P, Deng XW, Wei N RT Arabidopsis bZIP protein HY5 directly interacts with RT light-responsive promoters in mediating light control of gene RT expression RL Plant Cell 10:673-683 (1998) RD PubMed: 9596629; XX RA Hardtke CS, Gohda K, Osterlund MT, Oyama T, Okada K, Deng XW RT HY5 stability and activity in arabidopsis is regulated by RT phosphorylation in its COP1 binding domain RL EMBO J 19: 4997-5006 (2000) RD PubMed: 10990463; XX RA Oyama T, Shimura Y, Okada K RT The Arabidopsis HY5 gene encodes a bZIP protein that regulates RT stimulus-induced development of root and hypocotyl RL Genes Dev (1997) 11: 2983-2995 RD PubMed: 9367981; XX SQ TGACACGTGGCA // ID IBOX XX AC S000124 XX DT 7-Sep-2000 (last modified) seki XX DE "I box"; "I-box"; Conserved sequence upstream of light-regulated DE genes; Sequence found in the promoter region of rbcS of tomato DE and Arabidopsis; I box (Giuliano et al. 1988); Binding site of DE LeMYB1, that is a member of a novel class of myb-like proteins; DE LeMYBI act as a transcriptional activator; XX KW I box; I-box; rbcS; light regulation; light; LeMYB1, Myb-like KW protein; leaf; shoot; XX OS tomato (Lycopersicon esculentum); Arabidopsis thaliana; XX RA Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore RA AR RT An evolutionarily conserved protein binding sequence upstream of RT a plant light-regulated gene. RL Proc Natl Acad Sci USA 85:7089-7093 (1988) RD PubMed: 2902624; XX RA Donald RGK, Cashmore AR RT Mutation of either G box or l box sequences profoundly affects RT expression from the Arabidopsis rbcS-1A promoter. RL EMBO J 9:1717-1726 (1990) RD PubMed: 2347304; XX RA Rose A, Meier I, Wienand U RT The tamato I-box binding factor LeMYBI is a member of a novel RT class of Myb-like proteins RL Plant J 20: 641-652 (1999) RD PubMed: 10652136; XX SQ GATAAG // ID IBOXCORE XX AC S000199 XX DT 2-May-1998 (last modified) kehi XX DE "I box"; "I-box"; Conserved sequence upstream of light-regulated DE genes; Conserved sequence upstream of light-regulated genes of DE both monocots and dicots; See IBOX (S000124); XX KW I box; I-box; rbcS; light regulation; light; leaf; shoot; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ GATAA // ID IBOXCORENT XX AC S000424 XX DT 29-Sep-2003 (last modified) kehi XX DE "I-box core motif" in the CAMs (conserved DNA modular arrays) DE associated with light-responsive promoter regions; See S000124 DE (GATAAG), S000199 (GATAA), S000213; XX KW I-box; CAM; light; XX OS Nicotiana plumbaginifolia (tobacco) XX RA Martinez-Hernandez A, Lopez-Ochoa L, Arguello-Astorga G, RA Herrera-Estrella L. RT Functional properties and regulatory complexity of a minimal RBCS RT light-responsive unit activated by phytochrome, cryptochrome, and RT plastid signals. RL Plant Physiol. 128:1223-1233 (2002) RD PubMed: 11950971; XX SQ GATAAGR // ID IBOXLSCMCUCUMISIN XX AC S000423 XX DT 29-Sep-2003 (last modified) kehi XX DE "I-box-like sequence" found in the region (from -254 to -215) of DE cucumisin (a subtilisin-like serine protease) in the fruit of DE melon (Cucumis melo L.); I-box-like sequence functions as a DE negative regulatory element; See S000199 (I-box, GATAA), S000124 DE (I-box, GATAAG); XX KW cucumisin; fruit; XX OS Cucumis melo L. (melon) XX RA Yamagata H, Yonesu K, Hirata A, Aizono Y. RT TGTCACA motif is a novel cis-regulatory enhancer element involved RT in fruit-specific expression of the cucumisin gene. RL J Biol Chem. 277:11582-11590 (2002) RD PubMed: 11782472; XX SQ AGATATGATAAAA // ID IDE1HVIDS2 XX AC S000463 XX DT 24-April-2005 (last modified) kehi XX DE IDE1 (iron-deficiency-responsive element 1) found at -153/-136 of DE barley IDS2 (iron deficiency specific clone 2) gene promoter; See DE also S000464; XX KW iron; root; XX OS Hordeum vulgare (barley) XX RA Kobayashi T, Nakayama Y, Itai RN, Nakanishi H, Yoshihara T, Mori RA S, Nishizawa NK. RT Identification of novel cis-acting elements, IDE1 and IDE2, of RT the barley IDS2 gene promoter conferring RT iron-deficiency-inducible, root-specific expression in RT heterogeneous tobacco plants. RL Plant J. 36: 780-793 (2003). RD PubMed: 14675444 XX RA Kobayashi T, Suzuki M, Inoue H, Itai RN, Takahashi M, Nakanishi RA H, Mori S, Nishizawa NK. RT Expression of iron-acquisition-related genes in iron-deficient RT rice is co-ordinately induced by partially conserved RT iron-deficiency-responsive elements. RL J Exp Bot. 56: 1305-1316. (2005) RD PubMed: 15781441 XX SQ ATCAAGCATGCTTCTTGC // ID IDE2HVIDS2 XX AC S000464 XX DT 24-April-2005 (last modified) kehi XX DE IDE2 (iron-deficiency-responsive element 2) found at -262/-236 of DE barley IDS2 (iron deficiency specific clone 2) gene promoter; See DE also S000463; XX KW iron; root; XX OS Hordeum vulgare (barley) XX RA Kobayashi T, Nakayama Y, Itai RN, Nakanishi H, Yoshihara T, Mori RA S, Nishizawa NK. RT Identification of novel cis-acting elements, IDE1 and IDE2, of RT the barley IDS2 gene promoter conferring RT iron-deficiency-inducible, root-specific expression in RT heterogeneous tobacco plants. RL Plant J. 36: 780-793 (2003). RD PubMed: 14675444 XX RA Kobayashi T, Suzuki M, Inoue H, Itai RN, Takahashi M, Nakanishi RA H, Mori S, Nishizawa NK. RT Expression of iron-acquisition-related genes in iron-deficient RT rice is co-ordinately induced by partially conserved RT iron-deficiency-responsive elements. RL J Exp Bot. 56: 1305-1316. (2005) RD PubMed: 15781441 XX SQ TTGAACGGCAAGTTTCACGCTGTCACT // ID IDRSZMFER1 XX AC S000445 XX DT 04-August-2006 (last modified) kehi XX DE "IDRS" (Iron-Dependent Regulatory Sequence) found in maize and DE Arabidopsis ferritin genes (Fer1); IDRS is responsible for DE transcriptional repression of ZmFer1 gene under low iron supply DE conditions; S=C/G; K=G/T; IDRS is not involved in the DE Fe-regulated expression of the AtAPX1 gene (Fourcroy et al., DE 2004); XX KW iron; ferritin; APX1; AtFer1; Fer; XX OS Zea mays (maize); Arabidopsis thaliana; XX RA Petit JM, van Wuytswinkel O, Briat JF, Lobreaux S. RT Characterization of an iron-dependent regulatory sequence RT involved in the transcriptional control of AtFer1 and ZmFer1 RT plant ferritin genes by iron. RL J Biol Chem. 276:5584-5590. (2001) RD PubMed: 11092880 XX RA Fourcroy P, Vansuyt G, Kushnir S, Inze D, Briat JF. RT Iron-regulated expression of a cytosolic ascorbate peroxidase RT encoded by the APX1 gene in Arabidopsis seedlings. RL Plant Physiol. 134: 605-613 (2004). . RD PubMed: 14739345 XX RA Tarantino D, Petit JM, Lobreaux S, Briat JF, Soave C, Murgia I. RT Differential involvement of the IDRS cis-element in the RT developmental and environmental regulation of the AtFer1 ferritin RT gene from Arabidopsis. RL Planta. 217: 709-716 (2003) RD PubMed: 12728319 XX RA Arnaud N, Murgia I, Boucherez J, Briat JF, Cellier F, Gaymard F. RT An iron-induced nitric oxide burst precedes ubiquitin-dependent RT protein degradation for arabidospsis atfer1 ferritin gene RT expression. RL J Biol Chem. 2006 Jun 16; [Epub ahead of print] RD PubMed: 16782706 XX SQ CACGAGSCCKCCAC // ID INRNTPSADB XX AC S000395 XX DT 21-May-2002 (last modified) uchi XX DE "Inr (initiator)" elements found in the tobacco psaDb gene DE promoter without TATA boxes; Light-responsive transcription of DE psaDb depends on Inr, but not TATA box; XX KW initiater; light-responsive transcription; TATA-less promoter; KW psaDb; Inr element; XX OS tobacco (Nicotiana tabacum) XX RA Nakamura M, Tsunoda T, Obokata J RT Photosynthesis nuclear genes generally lack TATA-boxes: a tobacco RT photosystem I gene responds to light through an initiater RL Plant J 29: 1-10 (2002) RD PubMed: 12060222 ; XX SQ YTCANTYY // ID INTRONLOWER XX AC S000086 XX DT 17-May-1998 (last modified) kehi XX DE "3' intron-exon splice junctions"; Plant intron lower sequence; DE Consensus sequence for plant introns; XX KW intron; splice junction; XX OS maize (Zea mays) XX RA Brown JWS RT A catalog of splice junction and putative branch point sequences RT from plant introns. RL Nucleic Acids Res 14:9549-9559 (1986) RC Review RD PubMed: 3808952; XX SQ TGCAGG // ID INTRONUPPER XX AC S000085 XX DT 17-May-1998 (last modified) kehi XX DE "5' exon-intron splice junctions" of plant introns; Plant intron DE upper sequence; Consensus sequence for plant introns; XX KW intron; splice junction; XX OS maize (Zea mays) XX RA Brown JWS RT A catalog of splice junction and putative branch point sequences RT from plant introns. RL Nucleic Acids Res 14:9549-9559 (1986) RC Review RD PubMed: 3808952; XX SQ MAGGTAAGT // ID IRO2OS XX AC S000505 XX DT 15-September-2006 (last modified) kehi XX DE OsIRO2-binding core sequence; "G-box plus G"; Transcription DE factor OsIRO2 is induced exclusively by Fe deficiency; XX KW root; shoot; Fe; iron; XX OS Oryza sativa (rice) XX RA Ogo Y, Itai RN, Nakanishi H, Inoue H, Kobayashi T, Suzuki M, RA Takahashi M, Mori S, Nishizawa NK. RT Isolation and characterization of IRO2, a novel iron-regulated RT bHLH transcription factor in graminaceous plants. RL J Exp Bot. 57:2867-2878. (2006) RD PubMed: 16887895 XX SQ CACGTGG // ID JASE1ATOPR1 XX AC S000388 XX DT 20-Feb-2002 (last modified) uchi XX DE "JASE1"found in promoter of Arabidopsis thaliana DE 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene; Located DE between -179 and -170; Involved in up-regulation by both DE senescence and JA; XX KW OPR1; senescence; Jasmonic acid; JASE1; JASE2; leaf; XX OS Arabidopsis thaliana XX RA He Y, Gan S RT Identical promoter elements are involved in regulation of the RT OPR1 gene by senescence and jasmonic acid in Arabidopsis RL Plant Mol Biol 47: 595-605 (2001) RD PubMed: 11725945; XX SQ CGTCAATGAA // ID JASE2ATOPR1 XX AC S000389 XX DT 20-Feb-2002 (last modified) uchi XX DE "JASE2"found in promoter of Arabidopsis thaliana DE 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene; Located DE between -112 and -100; Involved in up-regulation by both DE senescence and JA; JASE2 contains a mixed A/C box-like motif; XX KW OPR1; senescence; Jasmonic acid; JASE1; JASE2; leaf; XX OS Arabidopsis thaliana XX RA He Y, Gan S RT Identical promoter elements are involved in regulation of the RT OPR1 gene by senescence and jasmonic acid in Arabidopsis RL Plant Mol Biol 47: 595-605 (2001) RD PubMed: 11725945; XX SQ CATACGTCGTCAA // ID JERECRSTR XX AC S000384 XX DT 21-Nov-2002 (last modified) uchi XX DE "JERE" (jasmonate- and elicitor-responsive element) found in the DE periwinkle(C.R.) strictosidine synthase(Str) gene promoter; DE Located between -100 and -58; ORCA1, ORCA2 and ORCA3 bind DE specifically to the JERE of the Str promoter; Elicitor and MeJA DE rapidly induce Orca2, but not Orca1 mRNA levels; ORCA3 mRNA DE accumulation was rapidly induced by the metyljasmonate; XX KW JERE; JA; jasmonate; elicitor; strictosidine synthase(Str); KW ORCA1; ORCA2; ORCA3; AP2 domain; XX OS periwinkle(Catharanthus roseus) XX RA Menke FL, Champion A, Kijne JW, Memelink J RT A novel jasmonate- and elicitor-responsive element in the RT periwinkle secondary metabolite biosynthetic gene Str interacts RT with a jasmonate- and elicitor-inducible AP2-domain transcription RT factor, ORCA2 RL EMBO J 18: 4455-4463 (1999) RD PubMed: 10449411; XX RA van der Fits L, Memelink J RT The jasmonate-inducible AP2/ERF-domain transcription factor ORCA3 RT activates gene expression via interaction with a RT jasmonate-responsive promoter element RL Plant J 25: 43-53 (2001) RD PubMed: 11169181; XX RA Rushton PJ, Reinstadler A, Lipka V, Lippok B, Somssich IE RT Synthetic plant promoters containing defined regulatory elements RT provide novel insights into pathogen- and wound-induced RT signaling RL Plant Cell. 14: 749-762 (2002) RD PubMed: 11971132; XX SQ CTCTTAGACCGCCTTCTTTGAAAG // ID L1BOXATPDF1 XX AC S000386 XX DT 05-November-2005 (last modified) kehi XX DE "L1 box" found in promoter of Arabidopsis thaliana (A.t.) DE PROTODERMAL FACTOR1 (PDF1) gene; Located between -134 and -127; DE Involved in L1 layer-specific expression; L1-specific homeodomain DE protein ATML can bind to the "L1 box"; Y=C/T; A cotton fiber DE gene, RD22-like 1 (RDL1), contains a homeodomain binding L1 box DE and a MYB binding motif (Wang et al., 2004); HDZip IV; See also DE S000371; XX KW PDF1; L1 box; L1 layer-specific expression; Shoot apical KW meristem; SAM; organ primordia; cotton fiber; HDZip; homeodomain; KW leucine zipper; XX OS Arabidopsis thaliana; Gossypium spp (cotton); XX RA Abe M, Takahashi T, Komeda Y RT Identification of a cis-regulatory element for L1 layer-specific RT gene expression, which is targeted by an L1-specific homeodomain RT protein RL Plant J 26: 487-494 (2001) RD PubMed: 11439135; XX RA Wang S, Wang JW, Yu N, Li CH, Luo B, Gou JY, Wang LJ, Chen XY. RT Control of plant trichome development by a cotton fiber MYB RT gene. RL Plant Cell 16: 2323-2334 (2004) RD PubMed: 15316114 XX RA Henriksson E, Olsson AS, Johannesson H, Johansson H, Hanson J, RA Engstrom P, Soderman E. RT Homeodomain leucine zipper class I genes in Arabidopsis. RT Expression patterns and phylogenetic re RL Plant Physiol. 139: 509-518. (2005) RD PubMed: 16055682 XX RA Abe M, Katsumata H, Komeda Y, Takahashi T. RT Regulation of shoot epidermal cell differentiation by a pair of RT homeodomain proteins in Arabidopsis. RL Development. 130: 635-643.(2003) RD PubMed: 12505995 XX RA Ohashi Y, Oka A, Rodrigues-Pousada R, Possenti M, Ruberti I, RA Morelli G, Aoyama T. RT Modulation of phospholipid signaling by GLABRA2 in root-hair RT pattern formation. RL Science. 300: 1427-1430 (2003). RD PubMed: 12775839 XX SQ TAAATGYA // ID L1DCPAL1 XX AC S000504 XX DT 15-September-2006 (last modified) kehi XX DE "L1" element, found in PAL1 promoter in carrot (Daucus carota), DE is a protoplastization (dilution) responsive element; L1 contains DE Box L-like sequence (ACCTACCC); see also S000492 (BOXL CORE of DC DE PAL1); XX KW L1 XX OS Daucus carota (carrot) XX RA Takeda J, Ito Y, Maeda K, Ozeki Y. RT Assignment of UVB-responsive cis-element and RT protoplastization-(dilution-) and elicitor-responsive ones in the RT promoter region of a carrot phenylalanine ammonia-lyase gene RT (gDcPAL1). RL Photochem Photobiol. 76:232-238 (2002). RD PubMed: 12194222 XX SQ ATTCACCTACCC // ID L4DCPAL1 XX AC S000503 XX DT 15-September-2006 (last modified) kehi XX DE "L4" element, found in PAL1 promoter in carrot (Daucus carota), DE is a UV-B responsive element; L4 contains Box L-like sequence DE (TCCAACCA); see also S000492 (BoxL core of DC PAL); XX KW L4; PAL; XX OS Daucus carota (carrot) XX RA Takeda J, Ito Y, Maeda K, Ozeki Y. RT Assignment of UVB-responsive cis-element and RT protoplastization-(dilution-) and elicitor-responsive ones in the RT promoter region of a carrot phenylalanine ammonia-lyase gene RT (gDcPAL1). RL Photochem Photobiol. 76:232-238 (2002). RD PubMed: 12194222 XX SQ AATCTCCAACCA // ID LBOXLERBCS XX AC S000126 XX DT 17-May-1998 (last modified) kehi XX DE "L box"; Conserved sequence found in rbcS upstream sequences of DE both tomato (L.e.) and tobacco; XX KW L box; rbcS; leaf; shoot; XX OS tomato (Lycopersicon esculentum); tobacco (Nicotiana tabacum); XX RA Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore RA AR RT An evolutionarily conserved protein binding sequence upstream of RT a plant light-regulated gene. RL Proc Natl Acad Sci USA 85:7089-7093 (1988) RD PubMed: 2902624; XX RA Donald RGK, Cashmore AR RT Mutation of either G box or l box sequences profoundly affects RT expression from the Arabidopsis rbcS-1A promoter. RL EMBO J 9:1717-1726 (1990) RD PubMed: 2347304; XX SQ AAATTAACCAA // ID LEAFYATAG XX AC S000432 XX DT 27-Jan-2004 (last modified) kehi XX DE Target sequence of LEAFY in the intron of AGAMOUS gene in DE Arabidopsis; See Lohmann et al. Cell 105:793-803 (2003); XX KW LEAFY; AGAMOUS; XX OS Oryza sativa (rice); Arabidopsis thaliana; XX RA Kamiya N, Nagasaki H, Morikami A, Sato Y, Matsuoka M. RT Isolation and characterization of a rice WUSCHEL-tyope homoebox RT gene that is specifically expressed in the central cells of a RT quiescent center in the root apical meristem. RL Plant J. 35: 429-441 (2003) RD PubMed: 12904206; XX SQ CCAATGT // ID LECPLEACS2 XX AC S000465 XX DT 24-April-2005 (last modified) kehi XX DE Core element in LeCp (tomato Cys protease) binding cis-element DE (from -715 to -675) in LeAcs2 gene; XX KW cysteine protease; ethylene; xylanase; ACS; XX OS Lycopersicon esculentum (tomato) XX RA Matarasso N, Schuster S, Avni A. RT A novel plant cysteine protease has a dual function as a RT regulator of 1-aminocyclopropane-1-carboxylic Acid synthase gene RT expression. RL Plant Cell. 17: 1205-1216. (2005) RD PubMed: 15749766 XX SQ TAAAATAT // ID LEGUMINBOXLEGA5 XX AC S000060 XX DT 17-May-1998 (last modified) kehi XX DE "legumin box" in legA 5' legumin gene promoter in legumin; XX KW legumin; pea; tobacco; promoter; seed; XX OS pea (Pisum sativum); tobacco (Nicotiana tabacum); Vicia faba; XX RA Baumlein H, Wobus U, Pustell J, Kafatos FC RT The legumin gene family: structure of a B type gene of Vicia faba RT and a possible legumin gene specific regulatory element. RL Nucleic Acids Res 14:2707-2720 (1986) RD PubMed: 3960730; GenBank: X03677; XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX SQ TCCATAGCCATGCAWRCTGMAGAATGTC // ID LREBOX2PSRBCS3 XX AC S000061 XX DT 11-May-2006 (last modified) kehi XX DE "LRE (light-responsive element) Box II" of pea (P.s.) rbcS-3A DE gene; GT-1 binding; "GT-motif"; "GT1 motif"; Some similarity to DE SV40 enhancer core sequence; For a compilation of related GT DE elements and factors, see Villain et al. (1996); "BoxII" Binding DE site of transcriptional factor GTI; Located at -152 to -138; DE Confers light responsiveness; XX KW light; rbcS; GT-1; GT1; enhancer; core; Box II; LRE; GT element; KW leaf; shoot; XX OS pea (Pisum sativum); Arabidopsis thaliana; XX RA Green PJ, Kay SA, Chua N-H RT Sequence-specific interactions of a pea nuclear factor with RT light-responsive elements upstream of the rbcS-3A gene. RL EMBO J 6:2543-2549 (1987) RD PubMed: 3678200; XX RA Kuhlemeier C, Green PJ, Chua N-H RT Regulation of gene expression in higher plants RL Ann Rev Plant Physiol 38:221-257 (1987) RC Review XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Chattopadhyay S, Puente P, Deng X-W, Wei N RT Combinatorial interaction of ligth-responsive elements plays a RT critical role in determining the response characteristics of RT ligth-regulated promoters in Arabidopsis RL Plant J 15:69-77 (1998) RD PubMed: 9744096; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review XX RA Lam E, Chua NH RT GT-1 binding site confers light responsive expression in RT transgenic tobacco RL Science 248: 471-474 (1990) RD PubMed: 2330508 XX SQ TGTGTGGTTAATATG // ID LREBOX3PSRBCS3 XX AC S000062 XX DT 17-May-1998 (last modified) kehi XX DE "LRE (light-responsive element) Box III" of pea (P.s.) rbcS-3A DE gene; GT-1 binding; For a compilation of related GT elements and DE factors, see Villain et al. (1996); XX KW light; rbcS; GT-1; leaf; shoot; XX OS pea (Pisum sativum) XX RA Green PJ, Kay SA, Chua N-H RT Sequence-specific interactions of a pea nuclear factor with RT light-responsive elements upstream of the rbcS-3A gene. RL EMBO J 6:2543-2549 (1987) RD PubMed: 3678200; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX SQ ACTATTTTCACTATC // ID LREBOXIIPCCHS1 XX AC S000303 XX DT 10-Feb-2000 (last modified) seki XX DE "BoxII"; Light responsive element (LRE) found in the parsley DE (P.c.) CHS-1 (chalcone synthase-1) gene promoter; Required for DE light responsiveness; nuclear protein binding site; Highly DE conserved in various light inducible gene promoters; See DE S000302; XX KW chalcone synthase; CHS; light; Box II; LRE; leaf; shoot; XX OS parsley (Petroselinum crispum) XX RA Schulze-Lefert P, Dangl JL, Becker-Andre M, Hahlbrock K, Schulz RA W RT Inducible in vivo DNA footprints define sequences necessary for RT UV light activation of the parsley chalcon sythase gene RL EMBO J 8: 651-656 (1989) RD PubMed: 2566481 XX SQ TCCACGTGGC // ID LREBOXIPCCHS1 XX AC S000302 XX DT 16-Feb-2001 (last modified) seki XX DE "BoxI"; Light responsive element (LRE) found in the parsley DE (P.c.) CHS-1 (chalcone synthase-1) gene promoter; Required for DE light responsiveness; nuclear protein binding site; See S000303; DE "MRECHS" (MRE=Myb Recognition Element)Recognition site of MYB305 DE and a novel factor PcMYB1 (Myb1 from P. crispum); PcMYB1 contains DE only one MYB repeat; XX KW chalcone synthase; CHS; light; Box I; LRE; PcMYB1; MRECHS; MYB; KW leaf; shoot; XX OS parsley (Petroselinum crispum) XX RA Schulze-Lefert P, Dangl JL, Becker-Andre M, Hahlbrock K, Schulz RA W RT Inducible in vivo DNA footprints define sequences necessary for RT UV light activation of the parsley chalcone synthase gene RL EMBO J 8: 651-656 (1989) RD PubMed: 2566481 XX RA Feldbrugge M, Sprenger M, Hahlbrock K, Weisshaar B RT PcMYB1, a novel plant protein containing a DNA-binding domain RT with one MYB repeat, interacts in vivo with a light-regulatory RT promoter unit RL Plant J (1997) 11: 1079-1093 RD PubMed: 9193077; XX SQ AACCTAACCT // ID LRENPCABE XX AC S000231 XX DT 17-May-1998 (last modified) kehi XX DE "LRE"; A positive light regulatory element in tobacco (N.p.) CAB DE (cab-E) gene; Located at -241; XX KW CAB; cab; cab-E; CABE; light; leaf; shoot; XX OS tobacco (Nicotiana plumbaginifolia) XX RA Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR RT Both positive and negative regulatory elements mediate expression RT of a photoregulated CAB gene from Nicotiana plumbaginifolia RL EMBO J 7:1929-1936 (1988) RD PubMed: 2901343; GenBank: X12512; XX SQ ACGTGGCA // ID LS5ATPR1 XX AC S000323 XX DT 04-January-2007 (last modified) kehi XX DE "LS5"; A negative regulatory element found in the Arabidopsis DE (A.t.) PR-1 gene promoter; Binding site of TGA2; NPR1 increased DE the binding of TGA2 to the element; NPR1 is essential in DE activating systemic, inducible plant defense response; See DE S000322; TGA6 expressed in roots in young seedlings; TGA2.1 is a DE direct transcriptional activator; TGA2.2 stabilizes TGA2.1 DE binding; NOTE: The motif sequence previously shown was that of DE LS7. The correction was made. XX KW TGA2; LS5; LS7; SA; NPR1; TGA6; auxin; salicylic acid; root; XX OS Arabidopsis thaliana; tobacco (Nicotiana tabacum); XX RA Despres C, DeLong C, Glaze S, Liu E, Fobert PR RT The Arabidopsis NPR1/NIM1 protein enhances the DNA binding RT activity of a subgroup of the TGA family of bZIP transcription RT factors RL Plant Cell 12: 279-290 (2000) RD PubMed: 10662863; XX RA Xiang C, Miao Z, Lam E RT DNA-binding properties, genomic organization and expression RT pattern of TGA6,a new member of the TGA family of bZIP RT transcription factors in Arabidopsis thaliana RL Plant Mol Biol 34: 403-415 (1997) RD PubMed: 9225852 XX RA Niggeweg R, Thurow C, Weigel R, Pfitzner U, Gatz C RT Tobacco TGA factors differ with respect to interaction with NPR1, RT activation potential and DNA-binding properties. RL Plant Mol Biol 42: 775-788 (2000) RD PubMed: 10809449; XX RA Thurow C, Schiermeyer A, Krawczyk S, Butterbrodt T, Nickolov K, RA Gatz C. RT Tobacco bZIP transcription factor TGA2.2 and related factor RT TGA2.1 have distinct roles in plant defense responses and plant RT development. RL Plant J. 44:100-113 (2005) RD PubMed: 16167899 XX SQ TCTACGTCAC // ID LS7ATPR1 XX AC S000322 XX DT 04-January-2007 (last modified) kehi XX DE "LS7"; A positive salicylic acid-inducible element found in the DE Arabidopsis (A.t.) PR-1 gene promoter; Binding site of TGA1; NPR1 DE increased the binding of TGA2 to the element; NPR1 is essential DE in activating systemic, inducible plant defense responses; See DE S000323; TGA6 expressed in roots in young seedlings; TGA2.1 is a DE direct transcriptional activator; TGA2.2 stabilizes TGA2.1 DE binding; NOTE: The motif sequence previously shown was that of DE LS5. The correction was made. We are very sorry. XX KW TGA2; LS5; LS7; SA; NPR1; TGA6; auxin; salicylic acid; root; XX OS Arabidopsis thaliana; tobacco (Nicotiana tabacum); XX RA Despres C, DeLong C, Glaze S, Liu E, Fobert PR RT The Arabidopsis NPR1/NIM1 protein enhances the DNA binding RT activity of a subgroup of the TGA family of bZIP transcription RT factors RL Plant Cell 12: 279-290 (2000) RD PubMed: 10662863; XX RA Xiang C, Miao Z, Lam E RT DNA-binding properties, genomic organization and expression RT pattern of TGA6,a new member of the TGA family of bZIP RT transcription factors in Arabidopsis thaliana RL Plant Mol Biol 34: 403-415 (1997) RD PubMed: 9225852 XX RA Niggeweg R, Thurow C, Weigel R, Pfitzner U, Gatz C RT Tobacco TGA factors differ with respect to interaction with NPR1, RT activation potential and DNA-binding properties RL Plant Mol Biol 42: 775-788 (2000) RD PubMed: 10809449; XX RA Johnson C, Boden E, Arias J. RT Salicylic acid and NPR1 induce the recruitment of RT trans-activating TGA factors to a defense gene promoter in RT Arabidopsis. RL Plant Cell. 15:1846-1858 (2003) RD PubMed: 12897257 XX RA Thurow C, Schiermeyer A, Krawczyk S, Butterbrodt T, Nickolov K, RA Gatz C. RT Tobacco bZIP transcription factor TGA2.2 and related factor RT TGA2.1 have distinct roles in plant defense responses and plant RT development. RL Plant J. 44:100-113 (2005) RD PubMed: 16167899 XX SQ ACGTCATAGA // ID LTRE1HVBLT49 XX AC S000250 XX DT 11-Oct-1999 (last modified) kehi XX DE "LTRE-1" (low-temperature-responsive element) in barley (H.v.) DE blt4.9 gene promoter; A new LTRE; A previously known LTRE is DE CCGAC; XX KW low temperature; LTRE; XX OS barley (Hordeum vulgare) XX RA Dunn MA, White AJ, Vural S, Hughes MA RT Identification of promoter elements in a RT low-temperature-responsive gene (blt4.9) from barley (Hordeum RT vulgare L.) RL Plant Mol Biol 38:551-564 (1998) RD PubMed: 9747801; XX SQ CCGAAA // ID LTREATLTI78 XX AC S000157 XX DT 17-May-1998 (last modified) kehi XX DE Putative low temperature responsive element (LTRE); Found in DE Arabidopsis thaliana (A.t.) low-temperature-induced (lti) genes, DE lti78 and lti65; Repeated four times in lti78 which is also DE known as cor78 and rd29A (see S000152)(Baker et al., Plant Mol DE Biol 24:701(1994)); Found also in barley low temperature DE responsive genes, blt4.2, blt4.6, blt4.9 (lipid transfer genes); DE cold inducible; See LTRECORE (S000153); Also present in rab18, DE kin1, and kin2 (Nordin et al., 1993); XX KW low temperature responsive element; LTRE; cold; leaf; shoot; XX OS Arabidopsis thaliana; barley (Hordeum vulgare); XX RA Nordin K, Vahala T, Palva ET RT Differential expression of two related, low-temperature-induced RT genes in Arabidopsis thaliana (L.) Heynh. RL Plant Mol Biol 21:641-653 (1993) RC Consensus sequence among 2 genes; RD PubMed: 8448363; GenBank: X67670, X67671; XX RA White AJ, Dunn MA, Brown K, Hughes MA RT Comparative analysis of genomic sequence and expression of a RT lipid transfer protein gene family in winter barley. RL J Exp Bot 45:1885-1892 (1994) XX SQ ACCGACA // ID LTRECOREATCOR15 XX AC S000153 XX DT 8-February-2006 (last modified) kehi XX DE Core of low temperature responsive element (LTRE) of cor15a gene DE in Arabidopsis (A.t.); A portion of repeat-C (C-repeat), DE TGGCCGAC, which is repeated twice in cor15a promoter (Baker et DE al., 1994); ABA responsiveness; Involved in cold induction of DE BN115 gene from winter Brassica napus; LTRE; See S000157, DE S000152; Light signaling mediated by phytochrome is necessary for DE cold- or drought- induced gene expression through the C/DRE in DE Arabidopsis; See S000152; XX KW low temperature; cold; LTRE; drought; ABA; cor15a; BN115; leaf; KW shoot; phytochrome; XX OS Arabidopsis thaliana; Brassica napus XX RA Baker SS, Wilhelm KS, Thomashow MF RT The 5'-region of Arabidopsis thaliana cor15a has cis-acting RT elements that confer cold-, drought- and ABA-regulated gene RT expression. RL Plant Mol Biol 24:701-713 (1994) RD PubMed: 8193295; GenBank: U01377; XX RA Jiang C, Iu B, Singh J RT Requirement of a CCGAC cis-acting element for cold induction of RT the BN115 gene from winter Brassica napus RL Plant Mol Biol 30:679-684 (1996) RD PubMed: 8605318; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX RA Kim HJ, Kim YK, Park JY, Kim J RT Light signalling mediated by phytochrome plays an important role RT in cold-induced gene expression through the C-repeat/dehydration RT responsive element (C/DRE) in Arabidopsis thaliana RL Plant J 29: 693-704 (2002) RD PubMed: 12148528; XX SQ CCGAC // ID MARABOX1 XX AC S000063 XX DT 13-Feb-2001 (last modified) kehi XX DE "A-box" found in SAR(scaffold attachment region; or matrix DE attachment region, MAR); XX KW MAR; SAR; matrix; A-box; scaffold; XX OS Drosophila; fly; XX RA Gasser SM, Amati BB, Cardenas ME, Hofmann JFX RT Studies on scaffold attachment sites and their relation to genome RT function. RL Intnatl Rev Cyto 119:57-96 (1989) RC Review RD PubMed: 2695485; XX SQ AATAAAYAAA // ID MARARS XX AC S000064 XX DT 16-Jan-1998 (last modified) kehi XX DE "ARS element"; Motif found in SAR (MAR); XX KW MAR; SAR; ARS; XX OS yeast XX RA Gasser SM, Amati BB, Cardenas ME, Hofmann JFX RT Studies on scaffold attachment sites and their relation to genome RT function. RL Intnatl Rev Cyto 119:57-96 (1989) RC Review RD PubMed: 2695485; XX SQ WTTTATRTTTW // ID MARCEN3 XX AC S000065 XX DT 16-Jan-1998 (last modified) kehi XX DE "CEN III element"; Motif found in SAR (MAR); centromere element; XX KW MAR; SAR; ARS; CEN; centromere; XX OS yeast XX RA Gasser SM, Amati BB, Cardenas ME, Hofmann JFX RT Studies on scaffold attachment sites and their relation to genome RT function. RL Intnatl Rev Cyto 119:57-96 (1989) RC Review RD PubMed: 2695485; XX SQ TGTTTWTGNTTTCCGAAANNNNWWW // ID MARTBOX XX AC S000067 XX DT 13-Feb-2001 (last modified) kehi XX DE "T-Box"; Motif found in SAR (scaffold attachment region; or DE matrix attachment region, MAR); XX KW MAR; SAR; T-box; scaffold; matrix; XX OS Drosophila; fly; XX RA Gasser SM, Amati BB, Cardenas ME, Hofmann JFX RT Studies on scaffold attachment sites and their relation to genome RT function. RL Intnatl Rev Cyto 119:57-96 (1989) RC Review RD PubMed: 2695485; XX SQ TTWTWTTWTT // ID MEJARELELOX XX AC S000151 XX DT 17-May-1998 (last modified) kehi XX DE MeJa-responsive element (MeJaRE) in tomato (L. e.) lipoxygenase DE (LOX) gene; Related to tomato lipoxygenase gene expression during DE development and for MeJa (methyl jasmonate)-responsiveness; XX KW lipoxygenase; lox; methyl jasmonate; shoot; leaf; XX OS tomato (Lycopersicon esculentum); XX RA Beaudoin N, Rothstein SJ RT Developmental regulation of two tomato lipoxygenase promoters in RT transgenic tobacco and tomato. RL Plant Mol Biol 33:835-846 (1997) RD PubMed: 9106507; GenBank: U63117, U63118; XX SQ GATACANNAATNTGATG // ID MNF1ZMPPC1 XX AC S000251 XX DT 11-Oct-1999 (last modified) kehi XX DE "MNF1" binding site in maize (Z.m.) Ppc1 (phosphoenolpyruvate DE carboxylase) gene promoter; Involved in light induction; XX KW MNF1; Ppc1; light; leaf; shoot; XX OS maize (Zea mays) XX RA Morishima A RT Identification of preferred binding sites of a light-inducible RT DNA-binding factor (MNF1) within 5'-upstream sequence of C4-type RT phosphoenolpyruvate carboxylase gene in maize RL Plant Mol Biol 38:633-646 (1998) RD PubMed: 9747808; XX SQ GTGCCCTT // ID MREATCHS XX AC S000356 XX DT 02-August-2006 (last modified) kehi XX DE "MREAtCHS (MRE = Myb Recognition Element)" found in the LRU DE (light-responsive unit) in Arabidopsis (A.t.) chalcone synthase DE (CHS) gene promoter; Required for UV-B and UV-A/blue light DE responsiveness; See S000355; XX KW CHS; ACE; MYB; light; UV-A; UV-B; leaf; shoot; MRE; XX OS Arabidopsis thaliana XX RA Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, RA Weisshaar B RT Identification of UV/blue light-response elements in the RT Arabidopsis thaliana chalcone synthase promoter using a RT homologous protoplast transient expression system RL Plant Mol Biol (1998) 36: 741-754 RD PubMed: 9526507; XX RA Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B. RT Differential combinatorial interactions of cis-acting elements RT recognized by R2R3-MYB, BZIP, and BHLH factors control RT light-responsive and tissue-specific activation of RT phenylpropanoid biosynthesis genes. RL Plant Mol Biol. 57: 155-171 (2005). RD PubMed: 15821875 XX SQ TCTAACCTACCA // ID MRNA3ENDTAH3 XX AC S000069 XX DT 17-May-1998 (last modified) kehi XX DE Cis element in 3' end region of wheat (T.a.) histone H3 mRNA; 3' DE end formation; Also found in histone genes of other plants, DE yeast, etc; XX KW histone H3; mRNA; 3' end formation; meristem; XX OS wheat (Triticum aestivum); yeast; XX RA Ohtsubo N, Iwabuchi M RT The conserved 3'-flanking sequence, AATGGAAATG, of the wheat RT histone H3 gene is necessary for the accurate 3'-end formation of RT mRNA. RL Nucleic Acids Res 22:1052-1058 (1994) RD PubMed: 8152910; XX SQ AATGGAAATG // ID MRNASTA1CRPSBD XX AC S000274 XX DT 15-Oct-1999 (last modified) kehi XX DE mRNA stability determinant found in 5'-UTR of psbD mRNA of DE Chlamydomonas reinhardtii (C.r.); Required for the stable DE accumulation; Located within the first 12 nucleotides of the DE leader region; XX KW mRNA; stability; chloroplast; 5'-UTR; psbD; XX OS Chlamydomonas reinhardtii XX RA Nickelsen J, Fleischmann M, Boudreau E, Rahire M, Rochaix JD RT Identification of cis-acting RNA leader elements required for RT chloroplast psbD gene expression in Chlamydomonas RL Plant Cell 11:957-970 (1999) RD PubMed: 10330479; XX SQ CUCUUTGUTTUU // ID MRNASTA2CRPSBD XX AC S000275 XX DT 15-Oct-1999 (last modified) kehi XX DE mRNA stability determinant found in 5'-UTR of psbD mRNA of DE Chlamydomonas reinhardtii (C.r.); Required for the stable DE accumulation; Located near position -30 relative to the AUG DE initiation codon; XX KW mRNA; stability; chloroplast; 5'-UTR; psbD; XX OS Chlamydomonas reinhardtii XX RA Nickelsen J, Fleischmann M, Boudreau E, Rahire M, Rochaix JD RT Identification of cis-acting RNA leader elements required for RT chloroplast psbD gene expression in Chlamydomonas RL Plant Cell 11:957-970 (1999) RD PubMed: 10330479; XX SQ UGAGUUG // ID MSACRCYM XX AC S000236 XX DT 17-May-1998 (last modified) kehi XX DE "MSA (M-specific activator)" motif in Catharanthus roseus (C.r.) DE B-type cyclin (CYM) promoter; Essential for M phase-specific DE expression; Found at -66 to -58; XX KW M phase; cyclin; CYM; meristem; XX OS Catharanthus roseus XX RA Ito M, Iwase M, Kodama H, Lavisse P, Komamine A, Nishihama R, RA Machida Y, Watanabe A RT A novel cis-acting element in promoters of plant B-type cyclin RT genes activates M phase-specific transcription RL Plant Cell 10:331-341 (1998) RD PubMed: 9501108; XX SQ AGACCGTTG // ID MYB1AT XX AC S000408 XX DT 03-Jun-2003 (last modified) kehi XX DE MYB recognition site found in the promoters of the DE dehydration-responsive gene rd22 and many other genes in DE Arabidopsis; W=A/T; XX KW MYB; rd22BP1; ABA; leaf; seed; stress; XX OS Arabidopsis thaliana XX RA Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki RA K. RT Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as RT transcriptional activators in abscisic acid signaling. RL Plant Cell 15: 63-78 (2003) RD PubMed: 12509522; XX SQ WAACCA // ID MYB1LEPR XX AC S000443 XX DT 28-Jan-2004 (last modified) kehi XX DE Tomato Pti4(ERF) regulates defence-related gene expression via DE GCC box and non-GCC box cis elements (Myb1(GTTAGTT), G box DE (CACGTG)); XX KW Pti4; ERF; PR; MYB; XX OS Arabidopsis thaliana; Lycopersicon esculentum (tomato); XX RA Chakravarthy S, Tuori RP, DAscenzo MD, Fobert PR, Despres C, RA Martin GB RT The tomato transcription factor Pti4 regulates defence-related RT gene expression via GCC box and non-GCC box cis elements RL Plant Cell 15: 3033-3050 (2003) RD PubMed: 14630974; XX SQ GTTAGTT // ID MYB26PS XX AC S000182 XX DT 17-May-1998 (last modified) kehi XX DE Myb26 binding site; Myb26 recognizes the c-Myb and P-box-like DE binding sites representing cis-elements in the promoter regions DE of several phenylpropanoid biosynthetic genes; Identical to P-box DE in maize, and to Myb305 binding site in snapdragon; XX KW MYB; myb; Myb; myb26; P-box; P box; flower; XX OS pea (Pisum sativum) XX RA Uimari A, Strommer J RT Myb26: a MYB-like protein of pea flowers with affinity for RT promoters of phenylpropanoid genes RL Plant J 12:1273-1284 (1997) RD PubMed: 9450341; XX SQ GTTAGGTT // ID MYB2AT XX AC S000177 XX DT 16-May-2001 (last modified) uchi XX DE Binding site for ATMYB2, an Arabidopsis MYB homolog; ATMYB2 DE binds oligonucleotides that contained a consensus MYB recognition DE sequence (TAACTG), such as is in the SV40 enhancer and the maize DE bronze-1 promoter (Urao et al., Plant Cell 5:1529 (1993)); ATMYB2 DE is involved in regulation of genes that are responsive to water DE stress in Arabidopsis; See S000355; XX KW MYB; myb; SV40; enhancer; bronze; bronze-1; leaf; shoot; XX OS Arabidopsis thaliana; XX RA Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K RT An Arabidopsis myb homolog is induced by dehydration stress and RT its gene product binds to the conserved MYB recognition sequence RL Plant Cell 5:1529-1539 (1993) RD PubMed: 8312738; GenBank: D14712; XX SQ TAACTG // ID MYB2CONSENSUSAT XX AC S000409 XX DT 03-Jun-2003 (last modified) kehi XX DE MYB recognition site found in the promoters of the DE dehydration-responsive gene rd22 and many other genes in DE Arabidopsis; Y=C/T; K=G/T; See S000177 (MYB2), S000175 DE (MYBATRD22); XX KW MYB; rd22BP1; ABA; leaf; seed; stress; XX OS Arabidopsis thaliana XX RA Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki RA K. RT Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as RT transcriptional activators in abscisic acid signaling. RL Plant Cell 15: 63-78 (2003) RD PubMed: 12509522; XX SQ YAACKG // ID MYBATRD22 XX AC S000175 XX DT 16-May-2001 (last modified) uchi XX DE Binding site for MYB (ATMYB2) in dehydration-responsive gene, DE rd22; MYB binding site in rd22 gene of Arabidopsis thaliana; DE ABA-induction; Located at ca. -141 of rd22 gene; Also MYC at ca. DE -200 of rd22 gene; See S000174 (MYCATRD22); See S000355; XX KW Dehydration; Water stress; ABA; MYC; leaf; shoot; XX OS Arabidopsis thaliana XX RA Abe H, Yamaguchi-Shinozaki k, Urao T, Iwasaki T, Hosokawa D, RA Shinozaki K RT Role of Arabidopsis MYC and MYB homologs in drought- and abscisic RT acid-regulated gene expression. RL Plant Cell 9:1859-1868 (1997) RD PubMed: 9368419; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CTAACCA // ID MYBCORE XX AC S000176 XX DT 16-May-2001 (last modified) uchi XX DE Binding site for all animal MYB and at least two plant MYB DE proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis; DE ATMYB2 is involved in regulation of genes that are responsive to DE water stress in Arabidopsis; A petunia MYB protein (MYB.Ph3) is DE involved in regulation of flavonoid biosynthesis (Solano et al. DE EMBO J 14:1773 (1995)); See S000355; XX KW MYB; myb; dehydration; water; stress; flavonoid biosynthesis; KW leaf; shoot; XX OS Arabidopsis thaliana; animal; petunia (Petunia hybrida); XX RA Luscher B, Eiseman RN RT New light on Myc and Myb. Part II. Myb. RL Genes Dev. 4:2235-2241 (1990) RC Review RD PubMed: 2279697; XX RA Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K RT An Arabidopsis myb homolog is induced by dehydration stress and RT its gene product binds to the conserved MYB recognition sequence RL Plant Cell 5:1529-1539 (1993) RD PubMed: 8312738; GenBank: D14712; XX RA Solano R, Nieto C, Avila J, Canas L, Diaz I, Paz-Ares J RT Dual DNA binding specificity of a petal epidermis-specific MYB RT transcription factor (MYB.Ph3) from Petunia hybrida RL EMBO J 14:1773-1784 (1995) RD PubMed: 7737128; XX SQ CNGTTR // ID MYBCOREATCYCB1 XX AC S000502 XX DT 15-September-2006 (last modified) kehi XX DE "Myb core" in the 18 bp sequence which is able to activate DE reporter gene without leading to M-phase-specific expression, DE found in the promoter of Arabidopsis thaliana cyclin B1:1 gene; DE the 18 bp sequence share homology with a sequence found in the N. DE sylvestris cyclin B1 promoter (Trehin et al., 1999; see DE S000283): XX KW Cyc; M phase; Myb; XX OS Arabidopsis thaliana XX RA Planchais S, Perennes C, Glab N, Mironov V, Inze D, Bergounioux RA C. RT Characterization of cis-acting element involved in cell cycle RT phase-independent activation of Arath;CycB1;1 transcription and RT identification of putative regulatory proteins. RL Plant Mol Biol. 50:111-127 (2002). RD PubMed: 12139003 XX SQ AACGG // ID MYBGAHV XX AC S000181 XX DT 15-September-2006 (last modified) kehi XX DE Central element of gibberellin (GA) response complex (GARC) in DE high-pI alpha-amylase gene in barley (H.v.); Similar to c-myb and DE v-myb consensus binding site; GAmyb binds specifically to the DE TAACAAA box in vitro; GAmyb is the sole GA-regulated DE transcriptional factor required for transcriptional activation of DE the high-pI alpha-amylase; GARC consist of the pyrimidine, DE TAACAAA and TATCCAC boxes; GARE in RAmy1A gene; GARE and DE pyrimidine box in RAmy1A are partially involved in sugar DE repression; XX KW myb; Myb; GAmyb; GA; gibberellin; GARC; alph-amylase; amylase; KW aleurone; GARE; seed; XX OS barley (Hordeum vulgare); rice (Oryza sativa); XX RA Gubler F, Kalla R, Roberts JK, Jacobsen JV RT Gibberellin-regulated expression of a myb gene in barley aleurone RT cells: evidence for Myb transactivation of a high-pl RT alpha-amylase gene promoter RL Plant Cell 7:1879-1891 (1995) RD PubMed: 8535141; XX RA Morita A, Umemura T, Kuroyanagi M, Futsuhara Y, Perata P, RA Yamaguchi J RT Functional dissection of a sugar-repressed alpha-amylase gene RT (Ramy1A) promoter in rice embryos RL FEBS Lett 423:81-85 (1998) RD PubMed: 9506846; XX RA Gubler F, Raventos D, Keys M, Watts R, Mundy J, Jacobsen JV. RT Target genes and regulatory domains of the GAMYB transcriptional RT activator in cereal aleurone. RL Plant J. 17:1-9(1999). RD PubMed: 10069063 XX SQ TAACAAA // ID MYBPLANT XX AC S000167 XX DT 16-May-2001 (last modified) uchi XX DE Plant MYB binding site; Consensus sequence related to box P in DE promoters of phenylpropanoid biosynthetic genes such as PAL, CHS, DE CHI, DFR, CL, Bz1; Myb305; M=A/C; W=A/T; See S000355; The DE AmMYB308 and AmMYB330 transcription factors from Antirrhinum DE majus regulate phenylpropanoid and lignin biosynthesis in DE transgenic tobacco; XX KW Myb; MYB; Myb305; AmMYB308; AmMYB330; flower; PAL; CHS; DFR; KW Candi; Bz1; phenylpropanoid; lignin; leaf; shoot; XX OS snapdragon (Antirrhinum majus); bean (Phaseolus vulgaris); OS petunia (Petunia hybrida); Arabidopsis thaliana; maize (Zea OS mays); parsley (Petroselinum crispum); XX RA Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, RA Bevan M RT A flower-specific Myb protein activates transcription of RT phenylpropanoid biosynthetic genes. RL EMBO J 13:128-137 (1994) RD PubMed: 8306956; XX RA Tamagnone L, Merida A, Parr A, Mackay S, Culianez-Macia FA, RA Roberts K, Martin C RT The AmMYB308 and AmMYB330 transcription factors from antirrhinum RT regulate phenylpropanoid and lignin biosynthesis in transgenic RT tobacco RL Plant Cell 10: 135-154 (1998) RD PubMed: 9490739; XX SQ MACCWAMC // ID MYBPZM XX AC S000179 XX DT 17-May-1998 (last modified) kehi XX DE Core of consensus maize P (myb homolog) binding site; W=A/T; 6 bp DE core; Maize P gene specifies red pigmentation of kernel pericarp, DE cob, and other floral organs; P binds to A1 gene, but not Bz1 DE gene; Maize C1 (myb homolog) activates both A1 and Bz1 genes DE (Grotewold et al. 1994); W=A/T; XX KW P; P gene: P-gene; MYB; myb; seed; XX OS maize (Zea mays); XX RA Grotewold E, Drummond BJ, Bowen B, Peterson T RT The myb-homologous P gene controls phlobaphene pigmentation in RT maize floral organs by directly activating a flavonoid RT biosynthetic gene subset RL Cell 76:543-553 (1994) RD PubMed: 8313474; XX SQ CCWACC // ID MYBST1 XX AC S000180 XX DT 17-Apr-1998 (last modified) kehi XX DE Core motif of MybSt1 (a potato MYB homolog) binding site; MybSt1 DE cDNA clone was isolated by using CaMV 35S promoter domain A as a DE probe (Baranowskij et al. 1994); The Myb motif of the MybSt1 DE protein is distinct from the plant Myb DNA binding domain DE described so far; XX KW MYB; myb; Myb; XX OS potato (Solanum tuberosum); XX RA Baranowskij N, Frohberg C, Prat S, Willmitzer L RT A novel DNA binding protein with homology to Myb oncoproteins RT containing only one repeat can function as a transcriptional RT activator RL EMBO J 13:5383-5392 (1994) RD PubMed: 7957104; XX SQ GGATA // ID MYCATERD1 XX AC S000413 XX DT 29-November-2004 (last modified) kehi XX DE MYC recognition sequence (from -466 to -461) necessary for DE expression of erd1 (early responsive to dehydration) in DE dehydrated Arabidopsis; NAC protein bound specifically to the DE CATGTG motif (Tran et al., 2004)); NAC protein bound specifically DE to the CATGTG motif (Tran et al., 2004); XX KW water-stress; erd; XX OS Arabidopsis thaliana XX RA Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, RA Yamaguchi-Shinozaki K. RT Two different novel cis-acting elements of erd1, a clpA RT homologous Arabidopsis gene function in induction by dehydration RT stress and dark-induced senescence. RL Plant J. 33: 259-270 (2003) RD PubMed: 12535340; XX RA Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, RA Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. RT Isolation and functional analysis of arabidopsis stress-inducible RT NAC transcription factors that bind to a drought-responsive RT cis-element in the early responsive to dehydration stress 1 RT promoter. RL Plant Cell. 16: 2481-2498 (2004). RD PubMed: 15319476 XX SQ CATGTG // ID MYCATRD22 XX AC S000174 XX DT 29-Sep-1999 (last modified) kehi XX DE Binding site for MYC (rd22BP1) in Arabidopsis (A.t.) DE dehydration-resposive gene, rd22; MYC binding site in rd22 gene DE of Arabidopsis thaliana; ABA-induction; Located at ca. -200 of DE rd22 gene; Also MYB at ca. -141 of rd22 gene; See also S000175 DE (MYBATRD22); XX KW Dehydration; Water stress; ABA; MYC; myc; leaf; shoot; XX OS Arabidopsis thaliana XX RA Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, RA Shinozaki K RT Role of Arabidopsis MYC and MYB homologs in drought- and abscisic RT acid-regulated gene expression. RL Plant Cell 9:1859-1868 (1997) RD PubMed: 9368419; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810; XX SQ CACATG // ID MYCCONSENSUSAT XX AC S000407 XX DT 04-January-2007 (last modified) kehi XX DE MYC recognition site found in the promoters of the DE dehydration-responsive gene rd22 and many other genes in DE Arabidopsis; Binding site of ATMYC2 (previously known as DE rd22BP1); see S000144 (E-box; CANNTG), S000174 (MYCATRD22); DE N=A/T/G/C; MYC recognition sequence in CBF3 promoter; Binding DE site of ICE1 (inducer of CBF expression 1) that regulates the DE transcription of CBF/DREB1 genes in the cold in Arabidopsis; ICE1 DE (Chinnusamy et al., 2004);) This sequence is also known as RRE (R DE response element)(Hartmann et al., 2005); XX KW MYC; rd22BP1; ABA; leaf; seed; stress; CBF3; cold; CBF/DREB1; KW ICE1; RRE; XX OS Arabidopsis thaliana XX RA Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki RA K. RT Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as RT transcriptional activators in abscisic acid signaling. RL Plant Cell 15: 63-78 (2003) RD PubMed: 12509522; XX RA Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu RA JK. RT ICE1: a regulator of cold-induced transcriptome and freezing RT tolerance in Arabidopsis. RL Genes Dev. 17: 1043-1054 (2003) RD PubMed: 12672693; XX RA Chinnusamy V, Schumaker K, Zhu JK. RT Molecular genetic perspectives on cross-talk and specificity in RT abiotic stress signalling in plants. RL J Exp Bot. 55: 225-236 (2004). RC Review. RD PubMed: 14673035 XX RA Oh SJ, Song SI, Kim YS, Jang HJ, Kim SY, Kim M, Kim YK, Nahm BH, RA Kim JK. RT Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased RT tolerance to abiotic stress without stunting growth. RL Plant Physiology 138: 341-351 (2005) RD PubMed: 15834008 XX RA Lee BH, Henderson DA, Zhu JK. RT The Arabidopsis Cold-Responsive Transcriptome and Its Regulation RT by ICE1. RL Plant Cell. 17: 3155-3175 (2005) RD PubMed: 16214899 XX RA Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B. RT Differential combinatorial interactions of cis-acting elements RT recognized by R2R3-MYB, BZIP, and BHLH factors control RT light-responsive and tissue-specific activation of RT phenylpropanoid biosynthesis genes. RL Plant Mol Biol. 57: 155-171(2005). RD PubMed: 15821875 XX RA Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK. RT A R2R3 type MYB transcription factor is involved in the cold RT regulation of CBF genes and in acquired freezing tolerance. RL J Biol Chem. 281:37636-37645 (2006) RD PubMed: 17015446 XX SQ CANNTG // ID NAPINMOTIFBN XX AC S000070 XX DT 17-May-1998 (last modified) kehi XX DE Sequence found in 5' upstream region (-6, -95, -188) of napin (2S DE albumin) gene in Brassica napus (B.n.); Interact with a protein DE present in crude nuclear extracts from developing B. napus DE seeds; XX KW napin; 2S albumin; seed; storage protein; XX OS rape (Brassica napus) XX RA Ericson ML, Muren E, Gustavsson H-O, Josefsson L-G, Rask L RT Analysis of the promoter region of napin genes from Brassica RT napus demonstrates binding of nuclear protein in vitro to a RT conserved sequence motif. RL Eur J Biochem 197:741-746 (1991) RD PubMed: 2029903; GenBank: X58142; XX SQ TACACAT // ID NDEGMSAUR XX AC S000359 XX DT 16-Feb-2001 (last modified) seki XX DE "NDE" found in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene DE promoter; Required for auxin responsiveness; Contains two DE adjacent sequences, TGTCTC (see S000270) and GGTCCCAT, which have DE been previously identified as putative auxin-responsive elements; DE See S000360; XX KW NDE; SAUR; Auxin; XX OS Soybean (Glycine max) XX RA Li Y, Liu ZB, Shi X, Hagen G, Guilfoyle TJ RT An auxin-inducible element in soybean SAUR promoters RL Plant Physiol 106:37-43 (1994) RD PubMed: 7972520; XX SQ CCATATGCCATGTCTCTCAATTGGTCCCAT // ID NODCON1GM XX AC S000461 XX DT 24-April-2005 (last modified) kehi XX DE One of two putative nodulin consensus sequences; See also S000462 DE (NODCON2GM); XX KW nodulin XX OS Glycine max (soybean) XX RA Sandal NN, Bojsen K, Marcker KA. RT A small family of nodule specific genes from soybean. RL Nucleic Acids Res. 15:1507-1519 (1987). RC consesus; in silico; RD PubMed: 3822835 XX RA Stougaard J, Jorgensen JE, Christensen T, Kuhle A, Marcker KA. RT Interdependence and nodule specificity of cis-acting regulatory RT elements in the soybean leghemoglobin lbc3 and N23 gene RT promoters. RL Mol Gen Genet. 220: 353-360 (1990). RD PubMed: 2338938 XX SQ AAAGAT // ID NODCON2GM XX AC S000462 XX DT 24-April-2005 (last modified) kehi XX DE One of two putative nodulin consensus sequences; See also S000461 DE (NODCON1GM); XX KW nodulin XX OS Glycine max (soybean) XX RA Sandal NN, Bojsen K, Marcker KA. RT A small family of nodule specific genes from soybean. RL Nucleic Acids Res. 15:1507-1519 (1987). RC consesus; in silico; RD PubMed: 3822835 XX RA Stougaard J, Jorgensen JE, Christensen T, Kuhle A, Marcker KA. RT Interdependence and nodule specificity of cis-acting regulatory RT elements in the soybean leghemoglobin lbc3 and N23 gene RT promoters. RL Mol Gen Genet. 220: 353-360 (1990). RD PubMed: 2338938 XX SQ CTCTT // ID NONAMERATH4 XX AC S000147 XX DT 10-May-1998 (last modified) kehi XX DE Nonamer motif of Arabidopsis thaliana (A.t.) histone H4 DE promoter; XX KW nonamer; histone; H4; meristem; XX OS Arabidopsis thaliana; XX RA Chaubet N, Flenet M, Clement B, Brignon P, Gigot C RT Identification of cis-elements regulating the expression of an RT Arabidopsis histone H4 gene. RL Plant J 10:425-435 (1996) RD PubMed: 8811858; XX SQ AGATCGACG // ID NONAMERMOTIFTAH3H4 XX AC S000071 XX DT 17-May-1998 (last modified) kehi XX DE "Nonamer motif" found in promoter of wheat (T.a.) histone genes DE H3 and H4; XX KW HBP-1A; HBP-1B; wheat histone; CaMV 35S; NOS; meristem; XX OS wheat (Triticum aestivum); CaMV; XX RA Nakayama T, Sakamoto A, Yang P, Minami M, Fujimoto Y, Ito T, RA Iwabuchi M RT Highly conserved hexamer, octamer and nonamer motifs are positive RT cis-regulatory elements of the wheat histone H3 gene. RL FEBS Lett 300:167-170 (1992) RD PubMed: 1563517; GenBank: S95162; XX SQ CATCCAACG // ID NRRBNEXTA XX AC S000242 XX DT 11-0ct-1999 (last modified) kehi XX DE "NRR (negative regulatory region)" in promoter region of Brassica DE napus (B.n.) extA extensin gene; Removal of this region leads to DE expression in all tissues within the stem internode, petiole and DE root; XX KW ext; extensin; stem; internode; petiole; root; XX OS Brassica napus XX RA Elliott KA , Shirsat AH RT Promoter regions of the extA extensin gene from Brassica napus RT control activation in response to wounding and tensile stress RL Plant Mol Biol 37:675-687 (1998) RD PubMed: 9687071; XX SQ TAGTGGAT // ID NTBBF1ARROLB XX AC S000273 XX DT 15-Oct-1999 (last modified) kehi XX DE NtBBF1(Dof protein from tobacco) binding site in Agrobacterium DE rhizogenes (A.r.) rolB gene; Found in regulatory domain B (-341 DE to -306); Required for tissue-specific expression and auxin DE induction; XX KW rolB; Dof; auxin; domain B; root; shoot; meristem; vascular; XX OS Agrobacterium rhizogenes XX RA Baumann K, De Paolis A, Costantino P, Gualberti G RT The DNA binding site of the Dof protein NtBBF1 is essential for RT tissue-specific and auxin-regulated expression of the rolB RT oncogene in plants RL Plant Cell 11:323-333 (1999) RD PubMed: 10072394; GenBank: AJ009594; XX SQ ACTTTA // ID O2F1BE2S1 XX AC S000162 XX DT 17-May-1998 (last modified) kehi XX DE opaque-2 recognition site F1 in Bertholletia excelsa (Brazil nut DE tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 DE and F3 sequences of be2S1 promoter; F1 is hybrid C/G box; XX KW O2; opaque-2; be2S1; F1; seed; XX OS Brazil nut tree (Bertholletia excelsa); XX RA Vincentz M, Leite A, Neshich G, Vriend G, Mattar C, Barros L, RA Weinberg D, de Almeida ER, Paes de Carvalho M, Aragao F, Gander RA ES RT ACGT and vicilin core sequences in a promoter domain required for RT seed-specific expression of a 2S storage protein gene are RT recognized by the opaque-2 regulatory protein. RL Plant Mol Biol 34:879-889 (1997) RD PubMed: 9290640; GenBank: X78287; XX SQ TCCACGTCGA // ID O2F2BE2S1 XX AC S000163 XX DT 17-May-1998 (last modified) kehi XX DE opaque-2 recognition site F2 in Bertholletia excelsa (Brazil nut DE tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 DE and F3 sequences of be2S1 promoter; F2 is a new O2-binding DE sequence related to the O2 target sites of the Coix alpha-coxin, DE the maize b-32 genes and the AP-1 pseudopalindrome; XX KW O2; opaque-2; be2S1; seed; XX OS Brazil nut tree (Bertholletia excelsa) XX RA Vincentz M, Leite A, Neshich G, Vriend G, Mattar C, Barros L, RA Weinberg D, de Almeida ER, Paes de Carvalho M, Aragao F, Gander RA ES RT ACGT and vicilin core sequences in a promoter domain required for RT seed-specific expression of a 2S storage protein gene are RT recognized by the opaque-2 regulatory protein. RL Plant Mol Biol 34:879-889 (1997) RD PubMed: 9290640; GenBank: X78287; XX SQ GCCACCTCAT // ID O2F3BE2S1 XX AC S000164 XX DT 17-May-1998 (last modified) kehi XX DE opaque-2 recognition site F3 in Bertholletia excelsa (Brazil nut DE tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 DE and F3 sequences of be2S1 promoter; F3 is hybrid of A/G box; XX KW O2; opaque-2; be2S1; seed; XX OS Brazil nut tree (Bertholletia excelsa) XX RA Vincentz M, Leite A, Neshich G, Vriend G, Mattar C, Barros L, RA Weinberg D, de Almeida ER, Paes de Carvalho M, Aragao F, Gander RA ES RT ACGT and vicilin core sequences in a promoter domain required for RT seed-specific expression of a 2S storage protein gene are RT recognized by the opaque-2 regulatory protein. RL Plant Mol Biol 34:879-889 (1997) RD PubMed: 9290640; GenBank: X78287; XX SQ TCCACGTACT // ID OBF5ATGST6 XX AC S000304 XX DT 29-Sep-2003 (last modified) kehi XX DE "OBF5 (ocs element binding factor 5)" binding site found in the DE Arabidopsis (A.t.) GST6 gene promoter; Similar to Ocs sequence; DE Located between -426 and -401; See S000305; Overexpression of DE OBP3 lead to severe growth defect with altered root development DE and yellowish leaves; All OBP proteins contain transcriptional DE activation domains in their C-terminal region; Dof protein play DE important roles in plant growth and development; Binding site of DE OBF4 and OBF5; See S000305, S000346; XX KW GST; Ocs; OBF; OBP; auxin; SA; cycloheximide, Dof; TGA; pathogen; KW root; leaf; shoot; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Chen W, Chao G, Singh KB RT The promoter of a H202-inducible, Arabidopsis glutathione RT S-transferase gene contains closely linked OBF- and OBP1-binding RT sites RL Plant J 10: 955-966 (1996) RD PubMed: 9011080; XX RA Kang HG, Singh KB RT Characterization of salicylic acid-responsive, Arabidopsis Dof RT domain proteins: Overexpression of OBP3 leads to growth defects RL Plant J 21: 329-339 (2000) RD PubMed: 10758484; XX RA Zhang B, Foley RC, Singh KB RT Isolation and characterization of two related Arabidopsis RT ocs-element bZIP binding proteins RL Plant J (1993) 4: 711-716 RD PubMed: 8252072; GenBank: X69899; X69900; XX RA Zhang B, Chen W, Foley RC, Buttner M, Singh KB RT Interactions between distinct types of DNA binding proteins RT enhance binding to ocs element promoter sequences RL Plant Cell 7: 2241-2252 (1995) RD PubMed: 8718629; GenBank: X89192; XX SQ ATCTTATGTCATTGATGACGACCTCC // ID OBP1ATGST6 XX AC S000305 XX DT 29-Sep-2003 (last modified) kehi XX DE OBP1, 4, and 5 (OBF binding protein) binding site found in the DE Arabidopsis (A.t.) GST6 gene promoter; Located between -398 and DE -388; OBP1 is able to stimulate the binding of OBF proteins to DE the GST6 promoter; See S000304; Overexpression of OBP3 lead to DE severe growth defect with altered root development and yellowish DE leaves; All OBP proteins contain transcriptional activation DE domains in their C-term. region; Dof protein play important roles DE in plant growth and development; See S000304; XX KW GST; Ocs; OBF; OBP; auxin; SA; cycloheximide, Dof; root; leaf; KW shoot; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Chen W, Chao G, Singh KB RT The promoter of a H202-inducible, Arabidopsis glutathione RT S-transferase gene contains closely linked OBF- and OBP1-binding RT sites RL Plant J 10: 955-966 (1996) RD PubMed: 9011080; XX RA Kang HG, Singh KB RT Characterization of salicylic acid-responsive, Arabidopsis Dof RT domain proteins: Overexpression of OBP3 leads to growth defects RL Plant J 21: 329-339 (2000) RD PubMed: 10758484; XX RA Zhang B, Foley RC, Singh KB RT Isolation and characterization of two related Arabidopsis RT ocs-element bZIP binding proteins RL Plant J (1993) 4: 711-716 RD PubMed: 8252072; GenBank: X69899; X69900; XX RA Zhang B, Chen W, Foley RC, Buttner M, Singh KB RT Interactions between distinct types of DNA binding proteins RT enhance binding to ocs element promoter sequences RL Plant Cell 7: 2241-2252 (1995) RD PubMed: 8718629; GenBank: X89192; XX SQ TACACTTTTGG // ID OCETYPEIIINTHISTONE XX AC S000269 XX DT 15-Oct-1999 (last modified) kehi XX DE "Type III element"; Oct-containing composite element Type III DE found in tobacco (N.t.) histone gene promoter; Oct (octomer) DE motif is paired with CCAAT-box to form Type III element; Required DE for S-phase specific and meristematic tissue-specific DE expression; XX KW histone; Oct; OCE; CCAAT-box; Type III; S-phase; meristem; XX OS tobacco (Nicotiana tabacum) XX RA Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M RT Identification of three Kinds of mutually related composite RT elements conferring S phase-specific transcriptional activation RL Plant J 18:611-623 (1999) RD PubMed: 10417712; XX SQ GATCCGCGNNNNNNNNNNNNNNACCAATCS // ID OCETYPEIINTHISTONE XX AC S000268 XX DT 15-Oct-1999 (last modified) kehi XX DE "Type II element"; Oct-containing composite element Type II found DE in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is DE paired with TCA motif to form Type II element; Required for DE S-phase specific and meristematic tissue-specific expression; XX KW histone; Oct; OCE; TCA-motif; Type II; S-phase; meristem; XX OS tobacco (Nicotiana tabacum) XX RA Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M RT Identification of three Kinds of mutually related composite RT elements conferring S phase-specific transcriptional activation RL Plant J 18:611-623 (1999) RD PubMed: 10417712; XX SQ TCACGCGGATC // ID OCETYPEINTHISTONE XX AC S000267 XX DT 15-Oct-1999 (last modified) kehi XX DE "Type I element"; Oct-containing composite element Type I found DE in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is DE paired with Hex motif to form Type I element; Required for DE S-phase specific and meristematic tissue-specific expression; XX KW histone; Oct; OCE; Hex-motif; Type I; meristem; S-phase; XX OS tobacco (Nicotiana tabacum) XX RA Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M RT Identification of three Kinds of mutually related composite RT elements conferring S phase-specific transcriptional activation RL Plant J 18:611-623 (1999) RD PubMed: 10417712; XX SQ CCACGTCANCGATCCGCG // ID OCSELEMENTAT XX AC S000158 XX DT 16-Feb-2001 (last modified) seki XX DE "OCS element" in octopine synthase gene (OCS) of Ti-plasmid of DE Agrobacterium (A.t.); Binding with nuclear protein isolated from DE tobacco; See OCS motif (S000074); "ocs-like element"; Also found DE in Arabidopsis glutathione S-transferase gene (GST6); OBF (ocs DE element binding factor)-binding site; See S000346; Tandem OCSTF DE binding-sites are essential for the activity of the Ocs-element; DE The Ocs-element occures rarely in plant gene promoters; See DE S000357; XX KW octopine synthase; ocs; GST6; glutathione S-transferase; XX OS Agrobacterium tumefaciens; tobacco; Arabidopsis thaliana; XX RA Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG RT The ocs-element is a component of the promoters of several T-DNA RT and plant viral genes. RL EMBO J 8:4197-4204 (1989) RD PubMed: 2591372; XX RA Foley RC, Grossman C, Ellis JG, Llewellyn DJ, Dennis ES, Peacock RA WJ, Singh KB RT Isolation of a maize bZIP protein subfamily: candidates for the RT ocs-element transcription factor. RL Plant J 3: 669-679 (1993) RD PubMed: 8374617; XX RA Chen W, Chao G, Singh KB RT The promoter of a H2O2-inducible, Arabidopsis glutathione RT S-transferase gene contains closely linked OBF- and OBP1-binding RT sites RL Plant J 10:955-966 (1996) RD PubMed: 9011080; XX RA Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis RA ES, Peacock WJ RT Does the ocs-element occur as a functional component of the RT promoters of plant genes? RL Plant J (1993) 4: 433-443 RD PubMed: 8220489; XX SQ TGACGYAAGSRMTKACGYMM // ID OCSENHANMOTIFAT XX AC S000074 XX DT 16-Feb-2001 (last modified) seki XX DE "OCS enhancer element" in octopine synthase gene (OCS) of DE Ti-plasmid of Agrobacterium tumefaciens (A.t.); Binding with DE nuclear protein isolated from tobacco and maize; See S000346; DE Tandem OCSTF binding-sites are essential for the activity of the DE Ocs-element; The Ocs-element occures rarely in plant gene DE promoters; See S000357; "OCS palindrome" found in tobacco (N.t.) DE OCS (Octopine synthase gene) promoter; Located at -193 to -178; DE Binding site of ASF-1; Confers expression of the gene; XX KW octopine synthase; ocs; enhancer; ASF-1; XX OS Agrobacterium tumefaciens; tobacco (Nicotiana tabacum); maize OS (Zea mays); XX RA Singh K, Tokuhisa JG, Dennis ES, Peacock WJ RT Saturation mutagenesis of the octopine synthase enhancer: RT correlation of mutant phenotypes with binding of a nuclear RT protein factor. RL Proc Natl Acad Sci USA 86:3733-3737 (1989) RD PubMed: 2726750; XX RA Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis RA ES, Peacock WJ RT Does the ocs-element occur as a functional component of the RT promoters of plant genes? RL Plant J (1993) 4: 433-443 RD PubMed: 8220489; XX RA Fromm H, Katagiri F, Chua NH RT An octopine synthase enhancer element directs tissue-specific RT expression and binds ASF-1, a factor from tobacco nuclear RT extracts RL Plant Cell 1: 977-984 (1989) RD PubMed: 2562557; XX RA Tokuhisa JG, Singh K, Dennis ES, Peacock WJ RT A DNA-binding protein factor recognizes two binding domains RT within the octopine synthase enhancer element RL Plant Cell 2: 215-224 (1990) RD PubMed: 2152113; XX SQ ACGTAAGCGCTTACGT // ID OCSGMGH24 XX AC S000346 XX DT 16-Feb-2001 (last modified) seki XX DE "OCS element" found in the soybean (G.m) GH2/4 gene promoter; DE Required for auxin and salycylic acid responsiveness; Activated DE by both active and inactive auxin and salicylic acid analogues; DE See S000074, S000130, S000158, S000304; Tandem OCSTF DE binding-sites are essential for the activity of the Ocs-element; DE The Ocs-element occurs rarely in plant gene promoters; See DE S000357; XX KW OCS; auxin; salicylic acid; GH2/4; XX OS Soybean (Glycine max) XX RA Ulmasov T, Hagen G, Guilfoyle T RT The ocs element in the soybean GH2/4 promoter is activated by RT both active and inactive auxin and salicylic acid analogues RL Plant Mol Biol 26: 1055-1064 (1994) RD PubMed: 7811965; XX RA Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis RA ES, Peacock WJ RT Does the ocs-element occur as a functional component of the RT promoters of plant genes? RL Plant J (1993) 4: 433-443 RD PubMed: 8220489; XX SQ CGGTTTACGTAATCTCTTACATCA // ID OCSGMHSP26A XX AC S000357 XX DT 16-Feb-2001 (last modified) seki XX DE Ocs element found in soybean (Glycine max) heat shock gene DE (Gmhsp26-A) promoter; The element is a functional ocs-element; DE The element did not affect the promoter's response to heat or DE wounding; XX KW Ocs; Hsp; XX OS Soybean (Glycine max) XX RA Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis RA ES, Peacock WJ RT Does the ocs-element occur as a functional component of the RT promoters of plant genes? RL Plant J (1993) 4: 433-443 RD PubMed: 8220489; XX SQ TGATGTAAGAGATTACGTAA // ID OCTAMERMOTIFTAH3H4 XX AC S000076 XX DT 11-May-2006 (last modified) kehi XX DE "Octamer motif" found in promoter of wheat (T.a.) histone genes DE H3 and H4, and corn histone genes H3 and H4; Arabidopsis histone DE H4; "histone-specific octamer"; About half of the Oct motifs are DE present together with another element, HexA, TCA or CCAAT-box, DE forming OCES (Oct-containing composite elements); XX KW histone; Oct; S-phase; CaMV 35S; NOS; meristem; XX OS wheat (Triticum aestivum); maize (Zea mays); CaMV; Arabidopsis OS thaliana; tobacco (Nicotiana tabacum); XX RA Chaubet N, Philipps G, Chaboute M-E, Ehling M, Gigot C RT Nucleotide sequences of two corn histone H3 genes. Genomic RT organization of the corn histone H3 and H4 genes. RL Plant Mol Biol 6:253-263 (1986) XX RA Nakayama T, Sakamoto A, Yang P, Minami M, Fujimoto Y, Ito T, RA Iwabuchi M RT Highly conserved hexamer, octamer and nonamer motifs are positive RT cis-regulatory elements of the wheat histone H3 gene. RL FEBS Lett 300:167-170 (1992) RD PubMed: 1563517; GenBank: S95162; XX RA Chaubet N, Flenet M, Clement B, Brignon P, Gigot C RT Identification of cis-elements regulating the expression of an RT Arabidopsis histone H4 gene. RL Plant J 10:425-435 (1996) RD PubMed: 8811858; XX RA Taoka K, Kaya H, Nakayama T, Araki T, Meshi T, Iwabuchi M RT Identification of three Kinds of mutually related composite RT elements conferring S phase-specific transcriptional activation RL Plant J 18:611-623 (1999) RD PubMed: 10417712; XX SQ CGCGGATC // ID OCTAMOTIF2 XX AC S000116 XX DT 17-May-1998 (last modified) kehi XX DE Octamer motif found in histone-gene-specific consensus sequences; DE 200 base upstream from the initiation codon ATG; Exist in all of DE seven plant histone genes; XX KW octamer; histone; meristem; XX OS maize (Zea mays); XX RA Chaubet N, Philipps G, Chaboute M-E, Ehling M, Gigot C RT Nucleotide sequences of two corn histone H3 genes. Genomic RT organization of the corn histone H3 and H4 genes. RL Plant Mol Biol 6:253-263 (1986) XX SQ CGCGGCAT // ID OPAQUE2ZM22Z XX AC S000017 XX DT 17-May-2001 (last modified) uchi XX DE Opaque-2 (O2) target sequence in maize (Z.m.) 22- and 27-kD zein DE promoters; "ACGT motif"; Related to seed expression; "O2 target DE sequence"; Gene: maize 22-kD zein; transacting factor: 02; XX KW O2; opaque; 22-kD zein; seed; ACGT; opaque-2; XX OS maize (Zea mays) XX RA Schmidt RJ, Ketudat M, Aukerman MJ, Hoschek G RT Opaque-2 is a transcriptional activator that recognizes a RT specific target site in 22-kD zein genes RL Plant Cell 4:689-700 (1992) RD PubMed: 1392590; GenBank: M86591; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Ueda T, Waverczak W, Ward K, Sher N, Ketudat M, Schmidt RJ, RA Messing J RT Mutations of the 22- and 27-kD zein promoters affect RT transactivation by the opaque-2 protein RL Plant Cell 4:701-709 (1992) RD PubMed: 1392591; XX RA Singh KB RT Transcriptional Regulation in Plants: The Importance of RT Combinatorial Comtrol RL Plant Pysiol 118: 1111-1120 (1998) RC review RD PubMed: 9847085 XX SQ TCCACGTAGA // ID OPAQUE2ZMB32 XX AC S000077 XX DT 17-May-1998 (last modified) kehi XX DE "opaque-2 binding site" of maize (Z.m.) b-32 (type I DE ribosome-inactivating protein gene; O2; O2S; O2S and GARE form a DE gibberellin response complex (GARC)(Rogers and Rogers, 1992); XX KW opaque-2; o2; b-32; O2; O2S; coupling element; GARC; GARE; seed; XX OS maize (Zea mays) XX RA Muller M, Muth JR, Gallusci P, Knudsen S, Maddaloni M, Motto M, RA Schmitz D, Sorensen MB, Salamini F, von Wettstein D, Thompson RD RT Regulation of storage protein synthesis in cereal seeds: RT developmental and nutritional aspects. RL J Plant Physiol 145:606-613 (1995) XX RA Croissant-Sych Y, Okita TW RT Identification of positive and negative regulatory cis-elements RT of the rice glutelin Gt3 promoter. RL Plant Science 116:27-35 (1996) XX RA Lohmer S, Maddaloni M, Motto M, Di Fonzo N, Hartings H, Salamini RA F, Thompson RD RT The maize regulatory locus Opaque-2 encodes a DNA-binding protein RT which activates the transcription of the b-32 gene. RL EMBO J 10:617-624 (1991) RD PubMed: 2001677; XX RA Rogers JC, Rogers SW RT Definition and functional implications of gibberellin and RT abscisic acid cis-acting hormone response complexes. RL Plant Cell 4:1443-1451 (1992) RD PubMed: 1477557; XX RA Lanahan MB, Ho THD, Rogers SW, Rogers JC RT A gibberellin response complex in cereal alpha-amylase gene RT promoters. RL Plant Cell 4:203-211 (1992) RD PubMed: 1386000; XX SQ GATGAYRTGG // ID OSE1ROOTNODULE XX AC S000467 XX DT 24-April-2005 (last modified) kehi XX DE One of the consensus sequence motifs of organ-specific elements DE (OSE) characteristic of the promoters activated in infected cells DE of root nodules; See also S000468; XX KW leghemoglobin; Lb29; root; nodule; arbuscule; XX OS Vicia faba; Medicago truncatula; Glycine max; Sesbania rostrata; XX RA Vieweg MF, Fruhling M, Quandt HJ, Heim U, Baumlein H, Puhler A, RA Kuster H, Andreas MP. RT The promoter of the Vicia faba L. leghemoglobin gene VfLb29 is RT specifically activated in the infected cells of root nodules and RT in the arbuscule-containing cells of mycorrhizal roots from RT different legume and nonlegume plants. RL Mol Plant Microbe Interact. 17: 62-69 (2004). RD PubMed: 14714869 XX RA Fehlberg V, Vieweg MF, Dohmann EM, Hohnjec N, Puhler A, Perlick RA AM, Kuster H. RT The promoter of the leghaemoglobin gene VfLb29: functional RT analysis and identification of modules necessary for its RT activation in the infected cells of root nodules and in the RT arbuscule-containing cells of mycorrhizal roots. RL J Exp Bot. 56:799-806 (2005) RD PubMed: 15668224 XX SQ AAAGAT // ID OSE2ROOTNODULE XX AC S000468 XX DT 24-April-2005 (last modified) kehi XX DE One of the consensus sequence motifs of organ-specific elements DE (OSE) characteristic of the promoters activated in infected cells DE of root nodules; See also S000467; XX KW leghemoglobin; Lb29; root; nodule; arbuscule; XX OS Vicia faba; Medicago truncatula; Glycine max; Sesbania rostrata; XX RA Vieweg MF, Fruhling M, Quandt HJ, Heim U, Baumlein H, Puhler A, RA Kuster H, Andreas MP. RT The promoter of the Vicia faba L. leghemoglobin gene VfLb29 is RT specifically activated in the infected cells of root nodules and RT in the arbuscule-containing cells of mycorrhizal roots from RT different legume and nonlegume plants. RL Mol Plant Microbe Interact. 17: 62-69 (2004). RD PubMed: 14714869 XX RA Fehlberg V, Vieweg MF, Dohmann EM, Hohnjec N, Puhler A, Perlick RA AM, Kuster H. RT The promoter of the leghaemoglobin gene VfLb29: functional RT analysis and identification of modules necessary for its RT activation in the infected cells of root nodules and in the RT arbuscule-containing cells of mycorrhizal roots. RL J Exp Bot. 56:799-806 (2005) RD PubMed: 15668224 XX SQ CTCTT // ID P1BS XX AC S000459 XX DT 27-March-2004 (last modified) kehi XX DE PHR1-binding sequence found in the upstream regions of phosphate DE starvation responsive genes from several plant species; phr1 DE (phosphate starvation response 1) gene codes for PHR1 protein DE related to PSR1 gene in C. reinhardtii; XX KW phosphate; starvation; MYB; XX OS Arabidopsis thaliana; Lycopersicon esculentum (tomato); Medicago OS truncatula; Hordeum vulgare (barley); XX RA Rubio V, Linhares F, Solano R, Martin AC, Iglesias J, Leyva A, RA Paz-Ares J. RT A conserved MYB transcription factor involved in phosphate RT starvation signaling both in vascular plants and in unicellular RT algae. RL Genes Dev. 15: 2122-2133.(2001) RD PubMed: 11511543 XX RA Schunmann PH, Richardson AE, Smith FW, Delhaize E. RT Characterization of promoter expression patterns derived from the RT Pht1 phosphate transporter genes of barley (Hordeum vulgare L.). RL J Exp Bot. 55: 855-865. (2004) RD PubMed: 15020637 XX RA Schunmann PH, Richardson AE, Vickers CE, Delhaize E. RT Promoter analysis of the barley Pht1;1 phosphate transporter gene RT identifies regions controlling root expression and responsiveness RT to phosphate deprivation. RL Plant Physiol. 136: 4205-4214. (2004) RD PubMed: 15542491 XX SQ GNATATNC // ID PALBOXAPC XX AC S000137 XX DT 06-January-2006 (last modified) kehi XX DE Box A; Consensus; One of three putative cis-acting elements DE (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC DE 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes DE P, A, and L) alone, or the promoter region containing all of them DE together, conferred elicitor or light responsiveness. These DE elements appear to be necessary but not sufficient for elicitor- DE or light-mediated PAL gene activation." (Logemann et al., 1995); DE See also S000136 (Box P), S000138 (Box L); XX KW Box A; PAL; XX OS parsley (Petroselinum crispum) XX RA Logemann E, Parniske M, Hahlbrock K RT Modes of expression and common structural features of the RT complete phenylalanine ammonia-lyase gene family in parsley. RL Proc Natl Acad Sci USA 92:5905-5909 (1995) RD PubMed: 7597051; GenBank: L37355, L37356, L37357; XX SQ CCGTCC // ID PALBOXLPC XX AC S000138 XX DT 06-January-2006 (last modified) kehi XX DE Box L; Consensus; One of three putative cis-acting elements DE (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC DE 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes DE P, A, and L) alone, or the promoter region containing all of them DE together, conferred elicitor or light responsiveness. These DE elements appear to be necessary but not sufficient for elicitor- DE or light-mediated PAL gene activation." (Logemann et al., 1995); DE See also S000136 (Box P), S000137 (Box A); XX KW Box L; PAL; XX OS parsley (Petroselinum crispum) XX RA Logemann E, Parniske M, Hahlbrock K RT Modes of expression and common structural features of the RT complete phenylalanine ammonia-lyase gene family in parsley. RL Proc Natl Acad Sci USA 92:5905-5909 (1995) RD PubMed: 7597051; GenBank: L37355, L37356, L37357; XX SQ YCYYACCWACC // ID PALBOXPPC XX AC S000136 XX DT 06-January-2006 (last modified) kehi XX DE Box P; Consensus; One of three putative cis-acting elements DE (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC DE 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes DE P, A, and L) alone, or the promoter region containing all of them DE together, conferred elicitor or light responsiveness. These DE elements appear to be necessary but not sufficient for elicitor- DE or light-mediated PAL gene activation." (Logemann et al., 1995); DE See also S000137 (Box A), S000138 (Box L); XX KW Box P; PAL; XX OS parsley (Petroselinum crispum) XX RA Logemann E, Parniske M, Hahlbrock K RT Modes of expression and common structural features of the RT complete phenylalanine ammonia-lyase gene family in parsley. RL Proc Natl Acad Sci USA 92:5905-5909 (1995) RD PubMed: 7597051; GenBank: L37355, L37356, L37357; XX SQ YTYYMMCMAMCMMC // ID PALINDROMICCBOXGM XX AC S000255 XX DT 23-June-2006 (last modified) kehi XX DE Palindromic C-box in soybean (G.m.); bZIP factors, STGA1 and STFs DE (STF1 and STF2) found in soybean apical hypocotyl, bind to this DE sequence; XX KW C-box; bZIP; STGA1; STF; hypocotyl; TGA; SA; XX OS Glycine max(soybean); Arabidopsis thaliana XX RA Cheong YH, Yoo CM, Park JM, Ryu GR, Goekjian VH , Nagao RT, Key RA JL, Cho MJ, Hong JC RT STF1 is a novel TGACG-binding factor with a zinc-finger motif and RT a bZIP domain which heterodimerizes with GBF proteins RL Plant J 15:199-209 (1998) RD PubMed: 9721678; XX RA Thibaud-Nissen F, Wu H, Richmond T, Redman JC, Johnson C, Green RA R, Arias J, Town CD RT Development of Arabidopsis whole-genome microarrays and their RT application to the discovery of binding sites for the TGA2 RT transcription factor in salicylic acid-treated plants. RL Plant J 47:152-162 (2006) RC in silico based on whole-genome microarray analysis after ChIP XX SQ TGACGTCA // ID PASNTPARA XX AC S000336 XX DT 7-Sep-2000 (last modified) seki XX DE "pas"; as-1-related element found in the tobacco (N.t.) parA gene DE promoter; Involved in Cadmium responsiveness; Not related to DE copper responsiveness; Located between -68 and -49; XX KW parA; pas; cadmium; as-1; XX OS tobacco (Nicotiana tabacum) XX RA Kusaba M, Takahashi Y, Nagata T RT A multiple-stimuli-responsive as-1-related element of parA gene RT confers responsiveness to cadmium but not to copper RL Plant Physiol 111: 1161-1167 (1996) RD PubMed: 8756498; XX SQ TTACGCAAGCAATGACATCT // ID PE1ASPHYA3 XX AC S000196 XX DT 17-May-1998 (last modified) kehi XX DE PE1; Positively acting element found at -381 to -348 of oat DE (A.s.) phyA3 promoter; A general positive element (Terzaghi & DE Cashmore, 1995); XX KW phytochrome; phy; phyA; phyA3; leaf; shoot; XX OS oat (Avena sativa); XX RA Bruce WB, Quail PH RT cis-Acting elements involved in photoregulation of an oat RT phytochrome promoter in rice RL Plant Cell 2:1081-1089 (1990) RD PubMed: 2152109; XX RA Bruce WB, Deng X-W, Quial PH RT A negatively acting DNA sequence element mediates RT phytochrome-directed repression of phyA gene transcription. RL EMBO J 10:3015-3024 (1991) RD PubMed: 1915276; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ GAAATAGCAAATGTTAAAAATA // ID PE2FNTRNR1A XX AC S000455 XX DT 29-November-2004 (last modified) kehi XX DE "pE2F (proximal E2F elemen)" at -143bp of tobacco (N.t.) RNR1a DE promoter; E2F factors involved in gene induction at the G1/S DE transition of the cell cycle; Important for regulating specific DE RNR1a (ribonucleotide reductase large subunit) gene expression in DE response to UV-C irradiation; See S000367; XX KW E2F; RNR1a; UV-C; cell cycle; G1; S; XX OS Nicotiana tabacum (tobacco) XX RA Lincker F, Philipps G, Chaboute ME. RT UV-C response of the ribonucleotide reductase large subunit RT involves both E2F-mediated gene transcriptional regulation and RT protein subcellular relocalization in tobacco cells. RL Nucleic Acids Res. 32: 1430-1438 (2004). . RD PubMed: 14990748 XX SQ ATTCGCGC // ID PE3ASPHYA3 XX AC S000197 XX DT 17-May-1998 (last modified) kehi XX DE PE3; Positively acting element found at -111 to -81 (Bruce et DE al., 1991) of oat (A.s.) phyA3 promoter; XX KW phytochrome; phy; phyA; phyA3; leaf; shoot; XX OS oat (Avena sativa); XX RA Bruce WB, Quail PH RT cis-Acting elements involved in photoregulation of an oat RT phytochrome promoter in rice RL Plant Cell 2:1081-1089 (1990) RD PubMed: 2152109; XX RA Bruce WB, Deng X-W, Quial PH RT A negatively acting DNA sequence element mediates RT phytochrome-directed repression of phyA gene transcription. RL EMBO J 10:3015-3024 (1991) RD PubMed: 1915276; XX SQ CAGCTCCCATGGCTCTCCCATCCGCGCCGGT // ID PIATGAPB XX AC S000381 XX DT 23-Aug-2001 (last modified) uchi XX DE "PI" found in the Arabidopsis thaliana(A.T.) GAPB gene promoter; DE Located between -157 and -150; Mutations in the "PI" resulted in DE reductions of light-activated gene transcription; GAPB encodes DE the B subunit of chloroplast glyceraldehyde-3-phosphate DE dehydrogenase(GADPH) of A.T.; XX KW GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated KW transcription; XX OS Arabidopsis thaliana XX RA Chan CS, Guo L, Shih MC RT Promoter analysis of the nuclear gene encoding the chloroplast RT glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis RT thaliana RL Plant Mol Biol 46: 131-141 (2001) RD PubMed: 11442054; XX SQ GTGATCAC // ID PIIATGAPB XX AC S000382 XX DT 23-Sep-2001 (last modified) kehi XX DE "PII" found in the Arabidopsis thaliana(A.T.) GAPB gene promoter; DE Located between -69 and -50; Mutations in the "PII" resulted in DE reductions of light-activated gene transcription; GAPB encodes DE the B subunit of chloroplast glyceraldehyde-3-phosphate DE dehydrogenase(GADPH) of A.T.; XX KW GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated KW transcription; XX OS Arabidopsis thaliana XX RA Chan CS, Guo L, Shih MC RT Promoter analysis of the nuclear gene encoding the chloroplast RT glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis RT thaliana RL Plant Mol Biol 46: 131-141 (2001) RD PubMed: 11442054; XX SQ TTGGTTTTGATCAAAACCAA // ID POLASIG1 XX AC S000080 XX DT 18-November-2005 (last modified) kehi XX DE "PolyA signal"; poly A signal found in legA gene of pea, rice DE alpha-amylase; -10 to -30 in the case of animal genes. Near DE upstream elements (NUE) in Arabidopsis (Loke et al. 2005); XX KW poly A signal; NUE; FUE; XX OS pea (Pisum sativum); rice (Oryza sativa); Arabidopsis thaliana; XX RA Heidecker G, Messing J RT Structural analysis of plant genes. RL Ann Rev Plant Physiol 37:439-466 (1986) RC Review XX RA Joshi CP RT Putative polyadenylation signals in nuclear genes of higher RT plants: a compilation and analysis. RL Nucleic Acids Res 15:9627-9640 (1987) RD PubMed: 3697078; XX RA O'Neill SD, Kumagai MH, Majumdar A, Huang N, Sutliff TD, RA Rodriguez RL RT The alpha-amylase genes in Oryza sativa: Characterization of cDNA RT clones and mRNA expression during seed germination. RL Mol Gen Genet 221:235-244 (1990) RD PubMed: 2370848; GenBank: M24286, M24287; XX RA Loke JC, Stahlberg EA, Strenski DG, Haas BJ, Wood PC, Li QQ. RT Compilation of mRNA polyadenylation signals in Arabidopsis RT revealed a new signal element and potential secondary RT structures. RL Plant Physiol. 138: 1457-1468. (2005) RC in silico RD PubMed: 15965016 XX SQ AATAAA // ID POLASIG2 XX AC S000081 XX DT 17-May-1998 (last modified) kehi XX DE "PolyA signal"; poly A signal found in rice alpha-amylase; -10 to DE -30 in the case of animal genes. AATAAA; AATAAT; AATTAAA; DE AATAAG; XX KW poly A signal; XX OS rice (Oryza sativa); animal; XX RA O'Neill SD, Kumagai MH, Majumdar A, Huand N, Sutliff TD, RA Rodriguez RL RT The alpha-amylase genes in Oryza sativa: Characterization of cDNA RT clones and mRNA expression during seed germination. RL Mol Gen Genet 221:235-244 (1990) RD PubMed: 2370848; GenBank: M24286, M24287; XX SQ AATTAAA // ID POLASIG3 XX AC S000088 XX DT 11-May-2006 (last modified) kehi XX DE "Plant polyA signal"; Consensus sequence for plant DE polyadenylation signal; XX KW poly A; polyadenylation; XX OS maize (Zea mays) XX RA Heidecker G, Messing J RT Structural analysis of plant genes. RL Ann Rev Plant Physiol 37:439-466 (1986) RC Review XX RA Joshi CP RT Putative polyadenylation signals in nuclear genes of higher RT plants: a compilation and analysis. RL Nucleic Acids Res 15:9627-9640 (1987) RD PubMed: 3697078; XX SQ AATAAT // ID POLLEN1LELAT52 XX AC S000245 XX DT 26-October-2005 (last modified) kehi XX DE One of two co-dependent regulatory elements responsible for DE pollen specific activation of tomato (L.e.) lat52 gene; Found at DE -72 to -68 region; See S000246 (POLLEN2LELAT52); AGAAA and DE TCCACCATA (S000246) are required for pollen specific expression; DE Also found in the promoter of tomato endo-beta-mannanase gene DE (LeMAN5) gene (Filichkin et al. 2004); XX KW pollen; lat52; endo-beta-mannnanase; MAN; XX OS Lycopersicon esculentum (tomato) XX RA Bate N, Twell D RT Functional architecture of a late pollen promoter: RT pollen-specific transcription is developmentally regulated by RT multiple stage-specific and co-dependent activator elements RL Plant Mol Biol 37:859-869 (1998) RD PubMed: 9678581; XX RA Filichkin SA, Leonard JM, Monteros A, Liu PP, Nonogaki H. RT A novel endo-beta-mannanase gene in tomato LeMAN5 is associated RT with anther and pollen development. RL Plant Physiol. 134 1080-1087 (2004) RD PubMed: 14976239 XX SQ AGAAA // ID POLLEN2LELAT52 XX AC S000246 XX DT 11-Oct-1999 (last modified) kehi XX DE One of two co-dependent regulatory elements responsible for DE pollen specific activation of tomato (L.e.) lat52 gene; Found at DE -60 to -52 region; See S000245 (POLLEN1LELAT52); AGAAA (S000245) DE and TCCACCATA are required for pollen specific expression; XX KW pollen; lat52; XX OS tomato (Lycopersicon esculentum) XX RA Bate N, Twell D RT Functional architecture of a late pollen promoter: RT pollen-specific transcription is developmentally regulated by RT multiple stage-specific and co-dependent activator elements RL Plant Mol Biol 37:859-869 (1998) RD PubMed: 9678581; XX SQ TCCACCATA // ID PR2GCNT XX AC S000089 XX DT 10-May-1998 (last modified) kehi XX DE "GC element" conserved in the 5' upstream regions of group 2 PR DE protein genes (beta-1,3-glucanase (GLN2), chitinase (CHN17, DE CHN50)) of tobacco (N.t.); XX KW tobacco; group 2; pr-protein; GC element; chitinase; KW beta-1,3-glucanase; XX OS tobacco (Nicotiana tabacum); XX RA Ohme-Takagi M, Shinshi H RT Structure and expression of a tobacco beta-1,3-glucanase gene. RL Plant Mol Biol 15:941-946 (1990) RD PubMed: 2103484; GenBank: X53600; XX SQ TAARAGCCGCC // ID PREATPRODH XX AC S000450 XX DT 04-August-2006 (last modified) kehi XX DE "PRE (Pro- or hypoosmolarity-responsive element) found in the DE promoter region of proline dehydrogenase (ProDH) gene in DE Arabidopsis; Core of 9-bp sequence ACTCATCCT which is necessary DE for the efficient expression of ProDH in response to L-Pro and DE hypoosmolarity (Satoh et al., 2002); ATB2-binding site; Similar DE to GCN4 motif (ATGA(C/G)TCAT); ATB2 subgroup of bZIP DE transcription factors function as transcriptional activator for DE hypoosmolarity-inducible ProDH (Satoh et al., 2004); XX KW proline; ProDH; hypoosomolarity; bZIP; XX OS Arabidopsis thaliana XX RA Satoh R, Nakashima K, Seki M, Shinozaki K, Yamaguchi-Shinozaki RA K. RT ACTCAT, a novel cis-acting element for proline- and RT hypoosmolarity-responsive expression of the ProDH gene encoding RT proline dehydrogenase in Arabidopsis. RL Plant Physiol. 130:709-719 (2002). RD PubMed: 12376638 XX RA Satoh R, Fujita Y, Nakashima K, Shinozaki K, Yamaguchi-Shinozaki RA K. RT A novel subgroup of bZIP proteins functions as transcriptional RT activators in hypoosmolarity-responsive expression of the ProDH RT gene in Arabidopsis. RL Plant Cell Physiol. 45: 309-317 (2004). RD PubMed: 15047879 XX RA Weltmeier F, Ehlert A, Mayer CS, Dietrich K, Wang X, Schutze K, RA Alonso R, Harter K, Vicente-Carbajosa J, Droge-Laser W. RT Combinatorial control of Arabidopsis proline dehydrogenase RT transcription by specific heterodimerisation of bZIP RT transcription factors. RL EMBO J. 25:3133-3143. (2006) RD PubMed: 16810321 XX SQ ACTCAT // ID PRECONSCRHSP70A XX AC S000506 XX DT 04-January-2007 (last modified) kehi XX DE Consensus sequence of PRE (plastid response element) in the DE promoters of HSP70A in Chlamydomonas; Involved in induction of DE HSP70A gene by both MgProto and light; S=G/C; Y=C/T; R=A/G; DE H=T/C/A; D=A/T/G; XX KW HSP; chlorophyl; MgProto; XX OS Chlamydomonas reinhardtii XX RA von Gromoff ED, Schroda M, Oster U, Beck CF. RT Identification of a plastid response element that acts as an RT enhancer within the Chlamydomonas HSP70A promoter. RL Nucleic Acids Res. 34:4767-4779 (2006) RC consensus; RD PubMed: 16971458 XX SQ SCGAYNRNNNNNNNNNNNNNNNHD // ID PREMOTIFNPCABE XX AC S000230 XX DT 17-May-1998 (last modified) kehi XX DE Motif sequence repeated many times in two positive regulatory DE elements, PRE1 (-1554 to -1182) and PRE2 (-747 to -516) found far DE upstream in the tobacco (N.p.) CAB gene (cab-E) promoter; Confer DE maximum levels of photoregulated expression; XX KW PRE; cab; CAB; photoregulated genes; light-regulated genes; KW light; leaf; shoot; XX OS tobacco (Nicotiana plumbaginifolia) XX RA Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR RT Both positive and negative regulatory elements mediate expression RT of a photoregulated CAB gene from Nicotiana plumbaginifolia. RL EMBO J 7:1929-1936 (1988) RD PubMed: 2901343; GenBank: X12512; XX RA Terzaghi WB, Cashmore AR RT Light-regulated transcription RL Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995) RC Review XX SQ ACCGGCCCACTT // ID PROLAMINBOX XX AC S000091 XX DT 15-Oct-1999 (last modified) kehi XX DE "Prolamin Box"; -330 consensus sequence found in all zein genes; DE prolamin type consensus sequence found in the 5'upstream regions DE of seed storage proteins of maize (22 kDa zein); similar sequence DE found in 19 kDa zein, B-hordein (barley), gamma-gliadin (wheat), DE high M.W. glutenin (wheat); ESBF-1 enhanced transcriptional DE activation mediated by SPA (the endosperm-specific wheat bZIP DE factor); XX KW prolamin-box; zein; hordein; gliadin; glutenin; SPA; bZIP; EB; KW ESBF-1; endosperm; WPBF; DOF; seed; XX OS rice (Oryza sativa); maize (Zea mays); barley (Hordeum vulgare); OS wheat (Triticum aestivum); XX RA Brown JWS, Wandelt C, Feix G RT The upstream regions of zein genes: sequence analysis and RT expression in the unicellular green alga Acetabularia. RL Eur J Cell Biol 42:161-170 (1986) XX RA Maier U-G, Brown JWS, Toloczyki C, Feix G RT Binding of a nuclear factor to a consensus sequence in the 5' RT flanking region of zein genes from maize. RL EMBO J 6:17-22 (1987) XX RA Schmidt RJ, Ketudat M, Aukerman MJ, Hoschek G RT Opaque-2 is a transcriptional activator that recognizes a RT specific target site in 22-kD zein genes. RL Plant Cell 4:689-700 (1992) RD PubMed: 1392590; GenBank: M86591; XX RA Conlan RS, Hammond-Kosack M, Bevan M RT Transcription activation mediated by the bZIP factor SPA on the RT endosperm box is modulated by ESBF-1 in vitro RL Plant J 19:173-181 (1999) RD PubMed: 10476064; XX SQ CACATGTGTAAAGGT // ID PROLAMINBOXOSGLUB1 XX AC S000354 XX DT 16-Feb-2001 (last modified) seki XX DE "Prolamine box" found in the rice (O.s.) GluB-1 gene promoter; DE Involved in quantitative regulation of the GluB-1 gene; See DE S000276, S000277, S000278 (for elements in GluB-1); See S000001, DE S000091, S000265, S000341 (for Prolamin box); XX KW prolamine box; GluB-1; seed; endosperm; XX OS rice (Oryza sativa) XX RA Wu C, Washida H, Onodera Y, Harada K, Takaiwa F RT Quantitative nature of the Prolamin-box, ACGT and AACA motifs in RT a rice glutelin gene promoter: minimal cis-element requirements RT for endosperm-specific gene expression RL Plant J 23: 415-421 (2000) RD PubMed: 10929134; XX SQ TGCAAAG // ID PROXBBNNAPA XX AC S000263 XX DT 16-Feb-2001 (last modified) seki XX DE "prox B (proximal portion of B-box) found in napA gene of DE Brassica napus (B.n.); CA-rich sequence; Found between -130 and DE -124; Required for seed specific expression and ABA DE responsiveness; See S000262, S000264; dist B ABRE mediated DE transactivation by ABI3 adn ABI3-dependent response to ABA; a DE tetramer of the composite RY/G complex mediated only DE ABA-independent transactivation by ABI3; B2 domain of ABI3 is DE necessary for ABA-independent and ABA-dependent activation DE through the dist B ABRE; XX KW ABRE; ABA; prox B; B-box; seed; napA; napin; XX OS Brassica napus XX RA Ezcurra I, Ellerstrom M, Wycliffe P, Stalberg K, Rask L RT Interaction between composite elements in the napA promoter: both RT the B-box ABA-responsive complex and the RY/G complex are RT necessary for seed-specific expression RL Plant Mol Biol 40:699-709 (1999) RD PubMed: 10480393 XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RD PubMed: 9617810; XX RA Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M, Rask L RT Transactivation of the Brassica napus napin promoter by ABI3 RT requires interaction of the conserved B2 and B3 domains of ABI3 RT with different cis-elements: B2 mediates activation through an RT ABRE, whereas B3 interacts with an RY/G-box RL Plant J 24:57-66 (2000) RD PubMed: 11029704; XX SQ CAAACACC // ID PSREGIONZMZM13 XX AC S000253 XX DT 11-Oct-1999 (last modified) kehi XX DE Pollen specific (PS) region in maize (Z.m.) ZM13 gene promoter; DE Found at -84 to -53; XX KW pollen; ZM13; XX OS maize (Zea mays) XX RA Hamilton DA, Schwarz YH, Mascarenhas JP RT A monocot pollen-specific promoter contains separable RT pollen-specific and quantitative elements RL Plant Mol Biol 38:663-669 (1998) RD PubMed: 9747811; XX SQ TCGGCCACTATTTCTACGGGCAGCCAGACAAA // ID PYRIMIDINEBOXHVEPB1 XX AC S000298 XX DT 10-Feb-2000 (last modified) seki XX DE "Pyrimidine box" found in the barley (H.v.) EPB-1 (cysteine DE proteinase) gene promoter; Located between -120 to -113; Required DE for GA induction; See S000297, S000259; XX KW EPB; cysteine proteinase; GA; ABA; GARE; pyrimidine box; seed; KW aleurone; XX OS barley (Hordeum vulgare) XX RA Cercos M, Gomez-Cadenas A, Ho THD RT Hormonal regulation of a cysteine proteinase gene, EPB-1, in RT barley aleurone layers: cis- and trans-acting elements involved RT in the co-ordinated gene expression regulated by gibberellins and RT abscisic acid RL Plant J 19: 107-118 (1999) RD PubMed: 10476058 XX SQ TTTTTTCC // ID PYRIMIDINEBOXOSRAMY1A XX AC S000259 XX DT 19-August-2004 (last modified) kehi XX DE Pyrimidine box found in rice (O.s.) alpha-amylase (RAmy1A) gene; DE Gibberellin-respons cis-element of GARE and pyrimidine box are DE partially involved in sugar repression; Found in the promoter of DE barley alpha-amylase (Amy2/32b) gene which is induced in the DE aleurone layers in response to GA; BPBF protein binds DE specifically to this site; See S000265; XX KW alpha-amylase; sugar repression; GARE; pyrimidine box; feed-back KW metabolic repression; embryo; seed; Dof; BPBF; pbf; XX OS rice (Oryza sativa); barley (Hordeum vulgare); XX RA Morita A, Umemura T, Kuroyanagi M, Futsuhara Y, Perata P, RA Yamaguchi J RT Functional dissection of a sugar-repressed alpha-amylase gene RT (Ramy1A) promoter in rice embryos RL FEBS Lett 423:81-85 (1998) RD PubMed: 9506846; XX RA Mena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P RT A Role for the DOF Transcription Factor BPBF in the Regulation of RT Gibberellin-Responsive Genes in Barley Aleurone RL Plant Physiol. 130: 111-119 (2002) RD PubMed: 12226491; XX SQ CCTTTT // ID QARBNEXTA XX AC S000244 XX DT 11-0ct-1999 (last modified) kehi XX DE "QAR (quantitative activator region)" in promoter region of DE Brassica napus (B.n.) extA extensin gene; XX KW ext; extensin; XX OS Brassica napus XX RA Elliott KA , Shirsat AH RT Promoter regions of the extA extensin gene from Brassica napus RT control activation in response to wounding and tensile stress RL Plant Mol Biol 37:675-687 (1998) RD PubMed: 9687071; XX SQ AACGTGT // ID QELEMENTZMZM13 XX AC S000254 XX DT 11-Oct-1999 (last modified) kehi XX DE "Q(quantitative)-element" in maize (Z.m.) ZM13 gene promoter; DE Found at -107 to -102; Involved in expression enhancing activity; DE ZM13 is a maize homolog of tomato LAT52 gene; ZM13 is a DE pollen-specific maize gene; XX KW enhancing; ZM13; LAT52; pollen; XX OS maize (Zea mays) XX RA Hamilton DA, Schwarz YH, Mascarenhas JP RT A monocot pollen-specific promoter contains separable RT pollen-specific and quantitative elements RL Plant Mol Biol 38:663-669 (1998) RD PubMed: 9747811; XX SQ AGGTCA // ID RAV1AAT XX AC S000314 XX DT 7-Sep-2000 (last modified) seki XX DE Binding consensus sequence of Arabidopsis (A.t.) transcription DE factor, RAV1; RAV1 specifically binds to DNA with bipartite DE sequence motifs of RAV1-A (CAACA) and RAV1-B (CACCTG); RAV1 DE protein contain AP2-like and B3-like domains; The AP2-like and DE B3-like domains recognize the CAACA and CACCTG motifs, DE respectively; The expression level of RAV1 were relatively high DE in rosette leaves and roots; See S000315(CACCTG); XX KW RAV1; AP2; VP1; B3; root; leaf; shoot; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Kagaya Y, Ohmiya K, Hattori T RT RAV1, a novel DNA-binding protein, binds to bipartite recognition RT sequence through two distinct DNA-binding domains uniquely found RT in higher plants RL Nucleic Acids Res 27: 470-478 (1999) RD PubMed: 9862967; XX SQ CAACA // ID RAV1BAT XX AC S000315 XX DT 7-Sep-2000 (last modified) seki XX DE Binding consensus sequence of an Arabidopsis (A.t.) transcription DE factor, RAV1; RAV1 specifically binds to DNA with bipartite DE sequence motifs of RAV1-A (CAACA) and RAV1-B (CACCTG); RAV1 DE protein contain AP2-like and B3-like domains; The AP2-like and DE B3-like domains recognize the CAACA and CACCTG motifs, DE respectively; The expression level of RAV1 were relatively high DE in rosette leaves and roots; See S000314(CAACA); XX KW RAV1; AP2; VP1; B3; root; leaf; shoot; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Kagaya Y, Ohmiya K, Hattori T RT RAV1, a novel DNA-binding protein, binds to bipartite recognition RT sequence through two distinct DNA-binding domains uniquely found RT in higher plants RL Nucleic Acids Res 27: 470-478 (1999) RD PubMed: 9862967; XX SQ CACCTG // ID RBCSBOX2PS XX AC S000094 XX DT 15-Oct-1999 (last modified) kehi XX DE "rbcS box II"; 5' upstream region (-151) of pea (P.s.) rbcS gene; DE Binding with trans factor GT-1; one of GT-1 boxes; For a DE compilation of related GT elements and factors, see Villain et DE al. (1996); GT-1 may act as a molecular switch modulated by DE calcium-dependent phosphorylation and dephosphorylation in DE response to light signals; XX KW rbcS; box II; GT-1 box; GT-1; light; LRE; leaf; shoot; XX OS pea (Pisum sativum) XX RA Fluhr R, Kuhlemeier C, Nagy F, Chua N-H RT Organ-specific and light-induced expression of plant genes. RL Science 232:1106-1112 (1986) XX RA Green PJ, Yong M-H, Cuozzo M, Kano-Murakami Y, Silverstein P, RA Chua N-H RT Binding site requirements for pea nuclear protein factor GT-1 RT correlate with sequences required for light-dependent RT transcriptional activation of the rbcS-3A gene. RL EMBO J 7:4035-4044 (1988) RD PubMed: 3243271; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Marechal E, Hiratsuka K, Delgado J, Nairn A, Qin J, Chait BT, RA Chua NH RT Modulation of GT-1 DNA-binding activity by calcium-dependent RT phosphorylation RL Plant Mol Biol 40:373-386 (1999) RD PubMed: 10437822; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review XX SQ GTGTGGTTAATATG // ID RBCSBOX3PS XX AC S000095 XX DT 17-May-1998 (last modified) kehi XX DE "rbcS box III"; 5' upstream region (-114) of pea (P.s.) rbcS DE gene; binding with trans factor GT-1; one of GT-1 boxes; For a DE compilation of related GT elements and factors, see Villain et DE al. (1996); XX KW rbcS; box III; GT-1 box; GT-1; leaf; shoot; XX OS pea (Pisum sativum) XX RA Fluhr R, Kuhlemeier C, Nagy F, Chua N-H RT Organ-specific and light-induced expression of plant genes. RL Science 232:1106-1112 (1986) XX RA Green PJ, Yong M-H, Cuozzo M, Kano-Murakami Y, Silverstein P, RA Chua N-H RT Binding site requirements for pea nuclear protein factor GT-1 RT correlate with sequences required for light-dependent RT transcriptional activation of the rbcS-3A gene. RL EMBO J 7:4035-4044 (1988) RD PubMed: 3243271; XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX SQ ATCATTTTCACT // ID RBCSCONSENSUS XX AC S000127 XX DT 17-May-1998 (last modified) kehi XX DE "rbcS general consensus sequence"; AATCCAA or AATCCAAC; XX KW rbcS; G box; I box; leaf; shoot; XX OS tomato (Lycopersicon esculentum); petunia (Petunia hybrida); OS tobacco (Nicotiana tabacum); pea (Pisum sativum); soybean OS (Glycine max); XX RA Manzara T, Gruissem W RT Organization and expression of the genes encoding RT ribulose-1,5-bisphosphate carboxylase in higher plants. RL Photosynth Res 16:117-139 (1988) XX RA Donald RGK, Cashmore AR RT Mutation of either G box or l box sequences profoundly affects RT expression from the Arabidopsis rbcS-1A promoter. RL EMBO J 9:1717-1726 (1990) RD PubMed: 2347304; XX SQ AATCCAA // ID RBCSGBOXPS XX AC S000096 XX DT 17-May-1998 (last modified) kehi XX DE "rbcS G-box"; 5'upstream region (-211) of pea rbcS gene; binding DE with trans factor GBF (CG-1); Light-responsiveness; XX KW rbcS; G-box; G box; GBF; CG-1; light; leaf; shoot; XX OS pea (Pisum sativum); XX RA Gilmartin PM, Sarokin L, Memelink J, Chua N-H RT Molecular light switches for plant genes. RL Plant Cell 2:369-378 (1990) RD PubMed: 2152164; XX SQ CACATGGCACT // ID RBENTGA3 XX AC S000358 XX DT 16-Feb-2001 (last modified) seki XX DE "rbe (RSG binding element)" found in the tobacco (N.t.) GA3 gene DE promoter; Binding site of RSG (Repression of shoot growth); RSG DE is a bZIP transcriptional activator; RSG regulates the morphology DE of plants by controlling the endogenous amounts of GAs; XX KW RSG; rbe; rbeGA3; bZIP; GA3; gibberellin; leaf; shoot; XX OS tobacco (Nicotiana tabacum) XX RA Fukazawa J, Sakai T, Ishida S, Yamaguchi I, Kamiya Y, Takahashi RA Y RT Repression of shoot growth, a bZIP transcriptional activator, RT regulates cell elongation by controlling the level of RT gibberellins RL Plant Cell 12: 901-915 (2000) RD PubMed: 10852936; XX SQ TCCAACTTGGA // ID RE1ASPHYA3 XX AC S000195 XX DT 17-May-1998 (last modified) kehi XX DE RE1 (putative repressor element) responsible for Pfr-directed DE repression of oat (A.s.) phyA3 phytochrome gene; Also found in DE pea AS1 (asparagine synthetase) gene (Ngai, Tsai, Coruzzi: Plant DE J 12:1021-1234 (1997)); XX KW light; repression; phy; phyA; leaf; shoot; XX OS oat (Avena sativa); pea (Pisum sativum); XX RA Bruce WB, Deng XW, Quail PH RT A negatively acting DNA sequence element mediates RT phytochrome-directed repression of phyA gene transcription RL EMBO J 10:3015-3024 (1991) RD PubMed: 1915276; XX RA Ngai N, Tsai FY, Coruzzi G RT Light-induced transcriptional repression of the pea AS1 gene: RT identification of cis-elements and transfactors RL Plant J 12:1021-1034 (1997) RD PubMed: 9418044; XX SQ CATGGGCGCGG // ID REALPHALGLHCB21 XX AC S000362 XX DT 16-Feb-2001 (last modified) seki XX DE "REalpha" found in Lemna gibba Lhcb21 gene promoter; Located at DE -134 to -129; Binding site of proteins of whole-cell extracts; DE The DNA binding activity is high in etiolated plants but much DE lower in green plants; Required for phytochrome regulation; See DE S000363; XX KW REalpha; Lhcb21; phytochrome; REbeta; XX OS Lemna gibba XX RA Degenhardt J, Tobin EM RT A DNA binding activity for one of two closely defined phytochrome RT regulatory elements in an Lhcb promoter is more abundant in RT etiolated than in green plants RL Plant Cell 8: 31-41 (1996) RD PubMed: 8597658; XX SQ AACCAA // ID REBETALGLHCB21 XX AC S000363 XX DT 16-Feb-2001 (last modified) seki XX DE "REbeta" found in Lemna gibba Lhcb21 gene promoter; Located at DE -114 to -109; A GATA sequence created at a position six DE nucleotides upstream could replace the function of REbeta; DE Required for phytochrome regulation; See S000362; XX KW REalpha; Lhcb21; phytochrome; REbeta; XX OS Lemna gibba XX RA Degenhardt J, Tobin EM RT A DNA binding activity for one of two closely defined phytochrome RT regulatory elements in an Lhcb promoter is more abundant in RT etiolated than in green plants RL Plant Cell 8: 31-41 (1996) RD PubMed: 8597658; XX SQ CGGATA // ID REGION1OSOSEM XX AC S000300 XX DT 16-Feb-2001 (last modified) seki XX DE "region 1" ABRE-like sequence found in rice (O.s.) Osem gene DE promoter; Important for regulation by ABA; See S000102, S000299; DE TRAB1, bZIP transcription factor, interacts with VP1 and mediates DE abscisic acid-induced transcritption; XX KW ABRE; Em; Osem; ABA; VP1; seed; XX OS rice (Oryza sativa) XX RA Hattori T, Terada t, Hamasuna S RT Regulation of the Osem gene by abscisic acid and the RT transcriptional activator VP1: analysis of cis-acting promoter RT elements required for regulation by abscisic acid and VP1 RL Plant J 7: 913-925 (1995) RD PubMed: 7599651; GenBank: U22102 XX RA Hobo T, Kowyama Y, Hattori T RT A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic RT acid-induced transcription RL Proc Natl Acad Sci USA 96: 15348-15353 (1999) RD PubMed: 10611387; XX SQ CGGCGGCCTCGCCACG // ID RGATAOS XX AC S000191 XX DT 17-May-1998 (last modified) kehi XX DE R-GATA (GATA motif binding factor) binding site; GATA motif is DE found at -143 to -135 of RTBV promoter; GATA motif is required DE for phloem-specific gene expression of Rice Tungro Bacilliform DE Virus (RTBV); See also RNFG1OS (S000188), RNFG2OS (S000189), and DE ABFOS (S000190); XX KW GATA; phloem; RTBV; R-GATA; stem; phloem; XX OS rice (Oryza sativa); RTBV; rice tungro bacilliform virus; XX RA Yin Y, Chen L, Beachy R RT Promoter elements required for phloem-specific gene expression RT from the RTBV promoter in rice RL Plant J 12:1179-1188 (1997) RD PubMed: 9418055; XX SQ CAGAAGATA // ID RHERPATEXPA7 XX AC S000512 XX DT 04-January-2007 (last modified) kehi XX DE "Right part of RHEs (Root Hair-specific cis-Elements)" conserved DE among the Arabidopsis thaliana A7 (AtEXPA7) orthologous (and DE paralogous) genes from diverse angiosperm species with different DE hair distribution patterns; K=G/T; W=T/A; XX KW root; hair; XX OS Arabidopsis thaliana XX RA Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT. RT Functional Conservation of a Root Hair Cell-Specific cis-Element RT in Angiosperms with Different Root Hair Distribution Patterns. RL Plant Cell. 18:2958-2970 (2006) RD PubMed: 17098810 XX SQ KCACGW // ID RNFG1OS XX AC S000188 XX DT 17-May-1998 (last modified) kehi XX DE RNFG1 binding site; Box I; RNFG1 is one of two Rice Nuclear DE Factors required for phloem-specific gene expression of Rice DE Tungro Bacilliform Virus (RTBV); Box I is found at -3 to +8 of DE RTBV promoter; See also RNFG2OS (S000189); XX KW RNFG1; phloem; RTBV; stem; phloem; XX OS rice (Oryza sativa); XX RA Yin Y, Beachy RN RT The regulatory regions of the rice tungro bacilliform virus RT promoter and interacting nuclear factors in rice (Oryza sativa RT L.) RL Plant J 7:969-980 (1995) RD PubMed: 7599653; XX SQ GATCATCGATC // ID RNFG2OS XX AC S000189 XX DT 12-Apri-2004 (last modified) kehi XX DE RNFG2 binding site; Box II; RNFG2 is one of two Rice Nuclear DE Factors required for phloem-specific gene expression of Rice DE Tungro Bacilliform Virus (RTBV); Box II is found at -53 to -39 of DE RTBV promoter; See also RNFG1OS (S000188); "Box II" is the DE binding site of bZIP protein RF2a and RF2b; RF2a and RF2b are DE predominantly expressed in vascular tissue (Dai et al.); XX KW RNFG1; phloem; RTBV; Box II; stem; phloem; RF2a; RF2b; bZIP; KW vascular; XX OS rice (Oryza sativa); XX RA Yin Y, Beachy RN RT The regulatory regions of the rice tungro bacilliform virus RT promoter and interacting nuclear factors in rice (Oryza sativa RT L.) RL Plant J 7:969-980 (1995) RD PubMed: 7599653; XX RA Yin Y, Chen L, Beachy R RT Promoter elements required for phloem-specific gene expression RT from the RTBV promoter in rice RL Plant J 12:1179-1188 (1997) RD PubMed: 9418055; XX RA Dai S, Zhang Z, Chen S, Beachy RN. RT RF2b, a rice bZIP transcription activator, interacts with RF2a RT and is involved in symptom development of rice tungro disease. RL Proc Natl Acad Sci U S A. 101:687-92.(2004) RD PubMed: 14704272; XX SQ CCAGTGTGCCCCTGG // ID ROOTMOTIFTAPOX1 XX AC S000098 XX DT 13-Feb-2001 (last modified) kehi XX DE Motif found both in promoters of rolD; XX KW root; rolD; XX OS Agrobacterium rhizogenes; XX RA Elmayan T, Tepfer M RT Evaluation in tobacco of the organ specificity and strength of RT the rol D promoter, domain A of the 35S promoter and the 35S^2 RT promoter RL Transgenic Res 4:388-396 (1995) RC Sequence similarity; RD PubMed: 7581519; XX SQ ATATT // ID RSEPVGRP1 XX AC S000099 XX DT 13-Feb-2001 (last modified) kehi XX DE "RSE (root-specific element)" of bean (P.v.) GRP1.8 gene; DE consensus sequence;See also S000288 and S000289; XX KW root; GRP1.8; XX OS bean (Phaseolus vulgaris) XX RA Elmayan T, Tepfer M RT Evaluation in tobacco of the organ specificity and strength of RT the rol D promoter, domain A of the 35S promoter and the 35S^2 RT promoter. RL Transgenic Res 4:388-396 (1995) RD PubMed: 7581519; XX SQ CAACTTTCATAT // ID RSEPVGRP18 XX AC S000289 XX DT 10-Feb-2000 (last modified) seki XX DE "RSE (root-specific element)" found in bean (P.V.) grp1.8 gene DE promoter; Located at -98 to -73; Required also for DE vascular-specific expression in stem; See S000288, S000099; XX KW RSE; grp1.8; vascular; root; stem; shoot; XX OS bean (Phaseolus vulgaris) XX RA Keller B, Heierli D RT Vascular expression of the grp1.8 promoter is controlled by three RT specific regulatory elements and one unspecific activating RT sequence RL Plant Mol Biol 26: 747-756 (1994) RD PubMed: 7948928 XX SQ CATCCAACTTTCATATCCATGTGCTT // ID RSRBNEXTA XX AC S000243 XX DT 11-0ct-1999 (last modified) kehi XX DE "RSR (root specific region)" in promoter region of Brassica napus DE (B.n.) extA extensin gene; XX KW root; XX OS Brassica napus XX RA Elliott KA , Shirsat AH RT Promoter regions of the extA extensin gene from Brassica napus RT control activation in response to wounding and tensile stress RL Plant Mol Biol 37:675-687 (1998) RD PubMed: 9687071; XX SQ CAAACTCGTATATCCAT // ID RYREPEAT4 XX AC S000010 XX DT 16-Feb-2001 (last modified) seki XX DE "RY repeat motif"; "Sph element"; seed expression; ABA; Gene: DE maize C1, wheat Em, rice rab16A, maize Rab17; Transacting factor: DE VP1 (maize C1); See S000105 RYREPEAT2 (CATGCAT); The RY sequence DE motif does not play a major role in VP1 or ABA regulation of Em DE gene in protoplast; VP1 gene is specifically required for DE expression of the maturation program in seed development; XX KW RY motif; C1; Em; Rab17; seed; ABA; VP1; Sph element; XX OS maize (Zea mays); wheat (Triticum aestivum); rice (Oryza sativa) XX RA Hattori T, Vasil V, Rosenkrans L, Hannah LC, McCarty DR, Vasil RA IK RT The Viviparous-1 gene and abscisic acid activate the C1 RT regulatory gene for anthocyanin biosynthesis during seed RT maturation in maize. RL Genes Dev 6:609-618 (1992) RD PubMed: 1532784; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Busk PK, Pages M RT Regulation of abscisic acid-induced transcription RL Plant Mol Biol 37:425-435 (1998) RC Review RD PubMed: 9617810 XX RA Vasil V, Marcotte Jr. WR, Rosenkrans L, Cocciolone SM, Vasil IK, RA Quatrano RS, McCarty DR RT Overlap of viviparous1 (VP1) and abscisic acid response elements RT in the EM promoter: G-Box elements are sufficient but not RT necessary for VP1 transactivation RL Plant Cell 7: 1511-1518 (1995) RD PubMed: 8589631 XX RA McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK RT The Viviparous-1 developmental gene of maize encodes a novel RT transcriptional activator RL Cell 66: 895-905 (1991) RD PubMed: 1889090; XX SQ TCCATGCATGCAC // ID RYREPEATBNNAPA XX AC S000264 XX DT 16-Feb-2001 (last modified) seki XX DE "RY repeat" found in RY/G box (the complex containing the two RY DE repeats and the G-box) of napA gene in Brassica napus (B.n.); DE Found between -78 and -50; Required for seed specific expression; DE See S000262, S000263; dist B ABRE mediated transactivation by DE ABI3 adn ABI3-dependent response to ABA; a tetramer of the DE composite RY/G complex mediated only ABA-independent DE transactivation by ABI3; B2 domain of ABI3 is necessary for DE ABA-independent and ABA-dependent activation through the dist B DE ABRE; XX KW RY repeat; RY/G box; seed; napA; napin; XX OS Brassica napus XX RA Ezcurra I, Ellerstrom M, Wycliffe P, Stalberg K, Rask L RT Interaction between composite elements in the napA promoter: both RT the B-box ABA-responsive complex and the RY/G complex are RT necessary for seed-specific expression RL Plant Mol Biol 40:699-709 (1999) RD PubMed: 10480393; XX RA Ezcurra I, Wycliffe P, Nehlin L, Ellerstrom M, Rask L RT Transactivation of the Brassica napus napin promoter by ABI3 RT requires interaction of the conserved B2 and B3 domains of ABI3 RT with different cis-elements: B2 mediates activation through an RT ABRE, whereas B3 interacts with an RY/G-box RL Plant J 24:57-66 (2000) RD PubMed: 11029704; XX SQ CATGCA // ID RYREPEATGMGY2 XX AC S000105 XX DT 11-May-2006 (last modified) kehi XX DE "RY repeat motif (CATGCAT)"; Present in the 5' region of the DE soybean (G.m.) glycinin gene (Gy2); XX KW glycinin; CATGCAT; Gy2; seed; XX OS soybean (Glycine max); XX RA Lelievre J-M, Oliveira LO, Nielsen NC RT 5'-CATGCAT-3' elements modulate the expression of glycinin RT genes. RL Plant Physiol 98:387-391 (1992) RD PubMed: 16668640 XX SQ CATGCAT // ID RYREPEATLEGUMINBOX XX AC S000100 XX DT 17-May-1998 (last modified) kehi XX DE "RY repeat (CATGCAY)" or legumin box found in seed-storage DE protein genes in legume such as soybean (G.m.); XX KW RY repeat; legumin box; seed; storage protein; XX OS legume; soybean (Glycine max); XX RA Fujiwara T, Beachy RN RT Tissue-specific and temporal regulation of a beta-conglycinin RT gene: roles of the RY repeat and other cis-acting elements. RL Plant Mol Biol 24:261-272 (1994) RD PubMed: 8111031; XX SQ CATGCAY // ID RYREPEATVFLEB4 XX AC S000102 XX DT 01-August-2006 (last modified) kehi XX DE "RY repeat motif"; quantitative seed expression; Gene: Vicia faba DE LeB4; Soybean glycinin (Gy2); other dicot and monocot seed DE protein genes; "Sph box" found in rice (O.s.) Osem gene promoter; DE See S000010, S000299, S000300; Binding site of Arabidopsis DE B3-domain-containing transcription factor FUS3; TRAB1, bZIP DE transcription factor, interacts with VP1 and mediates abscisic DE acid-induced transcritption; FUS3 protein physically interact DE with two RY elements present in the AtGA3ox promoter (Curaba et DE al., 2004); XX KW RY repeat motif; LeB4; Gy2; seed; Sph; ABA; VP1; Osem; Em; ABRE; KW FUS3; embryo; B3; GA; XX OS bean (Phaseolus vulgaris); soybean (Glycine max); Vicia faba; OS rice (Oryza sativa); Arabidopsis (Arabidopsis thaliana); XX RA Nag R, Maity MK, Dasgupta M. RT Dual DNA binding property of ABA insensitive 3 like factors RT targeted to promoters responsive to ABA and auxin. RL Plant Mol Biol. 59: 821-838 (2005). RD PubMed: 16270233 XX RA Baumlein H, Nagy I, Villarroel R, Inze D, Wobus U RT Cis-analysis of a seed protein gene promoter: the conservative RY RT repeat CATGCATG within the legumin box is essential for RT tissue-specific expression of a legumin gene. RL Plant J 2:233-239 (1992) RD PubMed: 1338774; XX RA Thomas TL RT Gene expression during plant embryogenesis and germination: An RT overview. RL Plant Cell 5:1401-1410 (1993) RC Review RD PubMed: 8281041; XX RA Hattori T, Terada t, Hamasuna S RT Regulation of the Osem gene by abscisic acid and the RT transcriptional activator VP1: analysis of cis-acting promoter RT elements required for regulation by abscisic acid and VP1 RL Plant J 7: 913-925 (1995) RD PubMed: 7599651; GenBank: U22102 XX RA Reidt W, Wohlfarth T, Ellerstrom M, Czihal A, Tewes A, Ezcurra I, RA Rask L, Baumlein H RT Gene regulation during late embryogenesis: the RY motif of RT maturation-specific gene promoters is a direct target of the FUS3 RT gene product RL Plant J 21: 401-408 (2000) RD PubMed: 10758492; XX RA Hobo T, Kowyama Y, Hattori T RT A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic RT acid-induced transcription RL Proc Natl Acad Sci USA 96: 15348-15353 (1999) RD PubMed: 10611387; XX RA Curaba J, Moritz T, Blervaque R, Parcy F, Raz V, Herzog M, Vachon RA G. RT AtGA3ox2, a Key Gene Responsible for Bioactive Gibberellin RT Biosynthesis, Is Regulated during Embryogenesis by LEAFY RT COTYLEDON2 and FUSCA3 in Arabidopsis. RL Plant Physiol. 136: 3660-3669. (2004) RD PubMed: 15516508 XX SQ CATGCATG // ID S1FBOXSORPS1L21 XX AC S000223 XX DT 10-May-1998 (last modified) kehi XX DE "S1F box" conserved both in spinach (S.o.) RPS1 and RPL21 genes DE encoding the plastid ribosomal protein S1 and L21, respectively; DE Negative element; Might play a role in downregulating RPS1 and DE RPL21 promoter activity (Lagrange et al., 1993); See S000211 DE (SITE1SORPS1), S000215 (S1FSORPL21); XX KW S1F; S1F box; S1F-box; S1; plastid protein; RPS1; RPL21; leaf; KW negative; XX OS spinach (Spinacia oleracea) XX RA Zhou DX, LI YF, Rocipon M, Mache R RT Sequence specific interaction between S1F, a spinach nuclear RT factor, and a negative cis-element conserved in plastid-related RT genes RL J Biol Chem 267:23515-23519 (1992) RD PubMed: 1429696; XX RA Lagrange T, Franzetti B, Axelos M, Mache R, Lerbs-Mache S RT Structure and expression of the nuclear gene encoding for the RT chloroplast ribosomal protein L21: Developmental regulation of a RT house-keeping gene by alternative promoters RL Mol Cell Biol 13:2614-2622 (1993) RD PubMed: 8455634; GenBank: M64682; XX SQ ATGGTA // ID S1FSORPL21 XX AC S000215 XX DT 19-August-2004 (last modified) kehi XX DE "S1F binding site" ("S1 site") in spinach (S.o.) RPL21 gene DE encoding the plastid ribosomal protein L21; Negative element; DE Might play a role in downregulating RPL21 promoter activity DE (Lagrange et al., 1993); See S000211 (SITE1SORPS1), S000166 DE (S2FSORPL21); XX KW S1F; S1; plastid protein; RPL21; leaf; negative; XX OS spinach (Spinacia oleracea) XX RA Zhou DX, LI YF, Rocipon M, Mache R RT Sequence specific interaction between S1F, a spinach nuclear RT factor, and a negative cis-element conserved in plastid-related RT genes RL J Biol Chem 267:23515-23519 (1992) RD PubMed: 1429696; XX RA Lagrange T, Franzetti B, Axelos M, Mache R, Lerbs-Mache S RT Structure and expression of the nuclear gene encoding for the RT chloroplast ribosomal protein L21: Developmental regulation of a RT house-keeping gene by alternative promoters RL Mol Cell Biol 13:2614-2622 (1993) RD PubMed: 8455634; GenBank: M64682; XX RA Lagrange T, Gauvin S, Yeo HJ, Mache R RT S2F, a leaf-specific trans-acting factor, binds to a novel RT cis-acting element and differentially activates the RPL21 gene RL Plant Cell 9:1469-1479 (1997) RD PubMed: 9286115; XX SQ ATGGTATT // ID S2FSORPL21 XX AC S000166 XX DT 17-May-1998 (last modified) kehi XX DE "S2F binding site" ("S2 site") in spinach RPL21 gene encoding the DE plastid ribosomal protein L21; S2 site (CATACAWW) is conserved in DE promoter region of many nuclear genes encoding plastid proteins; DE Leaf-specific, light-independent regulatory element; S2 site is DE related to but different from the light-responsive GT-1 binding DE site (Lagrange et al., 1997); For a compilation of related GT DE elements and factors, see Villain et al. (1996); XX KW S2F; S2; plastid protein; RPL21; leaf-specific; KW light-independent; light; GT element; leaf; shoot; XX OS spinach (Spinacia oleracea); XX RA Lagrange T, Gauvin S, Yeo HJ, Mache R RT S2F, a leaf-specific trans-acting factor, binds to a novel RT cis-acting element and differentially activates the RPL21 gene. RL Plant Cell 9:1469-1479 (1997) RD PubMed: 9286115; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX SQ CCATACATT // ID SARECAMV XX AC S000156 XX DT 16-Jan-1998 (last modified) kehi XX DE Salicylic acid responsive element found in CaMV 35S promoter; DE Identical to as-1; Binding with ASF-1 (Activation Sequence DE Factor-1); See AS1 (S000023); XX KW Salicylic acid; SARE; as-1; XX OS CaMV; Cauliflower mosaic virus; XX RA Qin X-F, Holuigue L, Horvath DM, Chua N-H RT Immediate early transcription activation by salicylic acid via RT the cauliflower mosaic virus as-1 element. RL Plant Cell 6:863-874 (1994) RD PubMed: 8061520; XX RA Stange C, Ramirez I, Gomez I, Jordana X, Holuigue L RT Phosphorylation of nuclear proteins directs binding to salicylic RT acid-responsive elements. RL Plant J 11:1315-1324 (1997) RD PubMed: 9225470; XX SQ CTGACGTAAGGGATGACGCAC // ID SB1NPABC1 XX AC S000435 XX DT 27-Jan-2004 (last modified) kehi XX DE Sclareol box1 (SB1) found at -827 of a plasma membrane ATP DE binding cassette (ABC) transporter gene (NpABC1) in N. DE plumbaginifolia; Mutation in SB3 completely abolished DE sclareolide-mediated expression; See S ; XX KW scalareol; diterpene; ABC; transporter; XX OS Nicotiana plumbaginifolia (tobacco); XX RA Grec S, Vanham D, de Ribaucourt J, Purnelle B, Boutry P. RT Identification of regulatory sequence elements within the RT transcription promoter region of NpABC1, a gene encoding a plant RT ABC transporter induced by diterpenes. RL Plant J. 35: 237-250 (2003) RD PubMed: 12848828; XX SQ CACTAACACAAAGTAA // ID SB3NPABC1 XX AC S000434 XX DT 27-Jan-2004 (last modified) kehi XX DE Sclareol box3 (SB3) found at -216 of a plasma membrane ATP DE binding cassette (ABC) transporter gene (NpABC1) in N. DE plumbaginifolia; Mutation in SB3 completely abolished DE sclareolide-mediated expression; See S ; XX KW sclareol; ABC; transporter; SB3; XX OS Nicotiana plumbaginifolia (tobacco); XX RA Grec S, Vanham D, de Ribaucourt J, Purnelle B, Boutry P. RT Identification of regulatory sequence elements within the RT transcription promoter region of NpABC1, a gene encoding a plant RT ABC transporter induced by diterpenes. RL Plant J. 35: 237-250 (2003) RD PubMed: 12848828; XX SQ TTATGAACAGTAATT // ID SBOXATRBCS XX AC S000500 XX DT 04-August-2006 (last modified) kehi XX DE "S-box" conserved in several rbcS promoters in Arabidopsis; ABI4 DE binding site; "Important for the sugar and ABA responsiveness of DE CMA5"(Acevedo-Hernandez et al., 2005); XX KW rbcS; sugar; ABA; ABI4; XX OS Arabidopsis thaliana XX RA Acevedo-Hernandez GJ, Leon P, Herrera-Estrella LR. RT Sugar and ABA responsiveness of a minimal RBCS light-responsive RT unit is mediated by direct binding of ABI4. RL Plant J. 43:506-519 (2005). RC in silico; Electrophoretic mobility shift assay; RD PubMed: 16098105 XX SQ CACCTCCA // ID SE1PVGRP18 XX AC S000288 XX DT 10-Feb-2000 (last modified) seki XX DE "SE1 (Stem element 1)" found in the bean (P.v.) grp1.8 gene DE promoter; Located between -121 and -94; Enhances the expression DE strongly but unspecifically; See S000289, S000101 (SE2); XX KW SE1; grp1.8; vascular; stem; shoot; XX OS bean (Phaseolus vulgaris) XX RA Keller B, Heierli D RT Vascular expression of the grp1.8 promoter is controlled by three RT specific regulatory elements and one unspecific activating RT sequence RL Plant Mol Biol 26: 747-756 (1994) RD PubMed: 7948928 XX SQ ATAATGGGCCACACTGTGGGGCAT // ID SE2PVGRP1 XX AC S000101 XX DT 17-May-1998 (last modified) kehi XX DE "SE2 (stem element 2)" of bean (P.v.) GRP1.8 gene; part of SE2 DE element; XX KW stem; SE2; GRP; GRP1; XX OS bean (Phaseolus vulgaris) XX RA Elmayan T, Tepfer M. RT Evaluation in tobacco of the organ specificity and strength of RT the rolD promoter, domain A of the 35S promoter and the 35S2 RT promoter. RL Transgenic Res 4:388-396 (1995) RD PubMed: 7581519; XX SQ TTNNNGTAGCTAGTGTATTTGTAT // ID SEBFCONSSTPR10A XX AC S000391 XX DT 20-Feb-2002 (last modified) uchi XX DE Binding site of the potato silencing element binding factor DE (SEBF) gene found in promoter of pathogenesis-related gene DE (PR-10a); Located between -45 and -39; Similar to the auxin DE response element; W=A/T; XX KW PR-10a; SEBF; pathogenesis; silencing; XX OS Solanum tuberosum (potato) XX RA Boyle B, Brisson N RT Repression of the defense gene PR-10a by the single-stranded DNA RT binding protein SEBF RL Plant Cell 13: 2525-2537 (2001) RD PubMed: 11701886; XX SQ YTGTCWC // ID SEF1MOTIF XX AC S000006 XX DT 17-May-1998 (last modified) kehi XX DE "SEF1 (soybean embryo factor 1)" binding motif; sequence found in DE 5'-upstream region (-640; -765) of soybean beta-conglicinin (7S DE globulin) gene; W=A/T; XX KW SOYBEAN; STORAGE PROTEIN; 7S; GLOBULIN; BETA-CONGLICININ; seed; XX OS soybean (Glycine max) XX RA Allen RD, Bernier F, Lessard PA, Beachy RN RT Nuclear factors interact with a soybean beta-conglycinin RT enhancer. RL Plant Cell 1:623-631 (1989) RD PubMed: 2535514; XX RA Lessard PA, Allen RD, Bernier F, Crispino JD, Fujiwara T, Beachy RA RN RT Multiple nuclear factors interact with upstream sequences of RT differentially regulated beta-conglycinin genes. RL Plant Mol Biol 16:397-413 (1991) RD PubMed: 1893110; XX SQ ATATTTAWW // ID SEF3MOTIFGM XX AC S000115 XX DT 17-May-1998 (last modified) kehi XX DE "SEF3 binding site"; Soybean (G.m.) consensus sequence found in DE the 5' upstream region of beta-conglycinin (7S globulin) gene; DE AACCCA(-27bp-)AACCCA; SEF=soybean embryo factor; SEF2; SEF3; DE SEF4; XX KW SEF3; beta-conglycinin; 7S; globulin; seed; XX OS soybean (Glycine max); XX RA Allen RD, Bernier F, Lessard PA, Beachy RN RT Nuclear factors interact with a soybean beta-conglycinin RT enhancer. RL Plant Cell 1:623-631 (1989) RD PubMed: 2535514; XX RA Lessard PA, Allen RD, Bernier F, Crispino JD, Fujiwara T, Beachy RA RN RT Multiple nuclear factors interact with upstream sequences of RT differentially regulated beta-conglycinin genes. RL Plant Mol Biol 16:397-413 (1991) RD PubMed: 1893110; XX SQ AACCCA // ID SEF4MOTIFGM7S XX AC S000103 XX DT 17-May-1998 (last modified) kehi XX DE "SEF4 binding site"; Soybean (G.m.) consensus sequence found in DE 5'upstream region (-199) of beta-conglycinin (7S globulin) gene DE (Gmg17.1); "Binding with SEF4 (soybean embryo factor 4)"; R=A/G; XX KW soybean; seed; storage protein; 7S; globulin; beta-conglycinin; KW SEF; XX OS soybean (Glycine max); XX RA Allen RD, Bernier F, Lessard PA, Beachy RN RT Nuclear factors interact with a soybean beta-conglycinin RT enhancer. RL Plant Cell 1:623-631 (1989) RD PubMed: 2535514; XX RA Lessard PA, Allen RD, Bernier F, Crispino JD, Fujiwara T, Beachy RA RN RT Multiple nuclear factors interact with upstream sequences of RT differentially regulated beta-conglycinin genes. RL Plant Mol Biol 16:397-413 (1991) RD PubMed: 1893110; XX SQ RTTTTTR // ID SGBFGMGMAUX28 XX AC S000287 XX DT 10-Feb-2000 (last modified) seki XX DE bZIP proteins SGBF-1 and SGBF-2 binding site in soybean (G.m.) DE GmAux28 gene promoter; see S000042; XX KW Aux28; G box; auxin; bZIP; SGBF-1; SGBF-2; XX OS soybean (Glycine max) XX RA Hong JC, Cheong YH, Nagao RT, Bahk JD, Key JL, Cho MJ RT Isolation of two soybean G-box binding factors which interact RT with a G-box sequences of an auxin-responsive gene RL Plant J 8: 199-211 (1995) RD PubMed: 7670504; GenBank: L01447, L01448, L01449 XX SQ TCCACGTGTC // ID SITE1SORPS1 XX AC S000211 XX DT 11-May-2006 (last modified) kehi XX DE Site 1 in the spinach (S.o.) rps1 promoter; S1F binding site; DE Nuclear genes encoding plastid ribosomal proteins are more highly DE expressed in leaves than in root; Involved in leaf-specific DE induction; Seems to be light-independent; Involved in negative DE regulation; Related to the light-responsive Box II of the pea DE rbcs-3A promoter; Related to GT elements; For a compilation of DE related GT elements and factors, see Villain et al. (1996); See DE S000215 (S1FSORPL21); S1 box=ATGGTA; XX KW Site 1; rps1; ribosomal protein; S1F; leaf; leaf-specific; KW repression; negative; XX OS spinach (Spinacia oleracea); XX RA Zhou DX, Li YF, Rocipon M, Mache R RT Sequence-specific interaction between S1F, a spinach nuclear RT factor, and a negative cis-element conserved in plastid-related RT genes RL J Biol Chem 267:23515-23519 (1992) RD PubMed: 1429696; XX RA Villain P, Clabault G, Mache R, Zhou DX RT S1F binding site is related to but different from the RT light-responsive GT-1 binding site and differentially represses RT the spinach rps1 promoter in transgenic tobacco RL J Biol Chem 269:16626-16630 (1994) RD PubMed: 8206981; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ TCATGGTAACAATT // ID SITE3SORPS1 XX AC S000212 XX DT 11-May-2006 (last modified) kehi XX DE Site 3 of spinach (S.o.) rps1 promoter; S1F binding site; For a DE compilation of related GT elements and factors, see Villain et DE al. (1996); XX KW Site 3; rps1; S1F; XX OS spinach (Spinacia oleracea) XX RA Villain P, Clabault G, Mache R, Zhou DX RT S1F binding site is related to but different from the RT light-responsive GT-1 binding site and differentially represses RT the spinach rps1 promoter in transgenic tobacco RL J Biol Chem 269:16626-16630 (1994) RD PubMed: 8206981; XX RA Villain P, Mache R, Zhou DX RT The mechanism of GT element-mediated cell type-specific RT transcriptional control RL J Biol Chem 271:32593-32598 (1996) RD PubMed: 8955086; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ AGTTAGTTAAAAGA // ID SITEIIAOSPCNA XX AC S000216 XX DT 11-May-2006 (last modified) kehi XX DE "Site IIa" of rice (O.s.) PCNA (proliferating cell nuclear DE antigen) gene; Found at -197 to -188; Binding site for two DE nuclear proteins, PCF1 and PCF2 (Kosugi and Ohashi, 1997); DE Suggested to be involved in meristematic tissue-specific DE expression; Resemble the conserved motif (T/GGTCCCAT) found in DE promoter regions of auxin-regulated genes; See S000026 DE (AUXREPSIAA4); XX KW PCNA; Site IIa; meristem; tissue-specific; XX OS rice (Oryza sativa) XX RA Kosugi S, Suzuka I, Ohashi Y RT Two of three promoter elements identified in a rice gene for RT proliferating cell nuclear antigen are essential for meristematic RT tissue-specific expression RL Plant J 7:877-886 (1995) RD PubMed: 7599648; XX RA Kosugi S, Ohashi Y RT PCF1 and PCF2 specifically bind to cis elements in the rice RT proliferating cell nuclear antigen gene RL Plant Cell 9:1607-1619 (1997) RD PubMed: 9338963; XX RA Zhou DX RT Regulatory mechanism of plant gene transcription by GT-elements RT and GT-factors RL Trends in Plant Science 4:210-214 (1999) RC Review RD PubMed: 10366876 XX SQ TGGGCCCGT // ID SITEIIATCYTC XX AC S000474 XX DT 01-August-2006 (last modified) kehi XX DE "Site II element" found in the promoter regions of cytochrome DE genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and DE -156 from the translational starts sites (Welchen et al., 2005); DE Y=C/T; See also S000308; Overrepresented in the promoters of DE nuclear genes encoding components of the oxidative DE phosphorylation (OxPhos) machinery from both Arabidopsis and rice DE (Welchen and Gonzalez, 2006);) XX KW cytochrome; TCP-domain; meristem; oxidative phosphorylation; XX OS Arabidopsis thaliana; Oryza sativa (rice); XX RA Welchen E, Gonzalez DH. RT Differential expression of the Arabidopsis cytochrome c genes RT Cytc-1 and Cytc-2. Evidence for the involvement of TCP-domain RT protein-binding elements in anther- and meristem-specific RT expression of the Cytc-1 gene. RL Plant Physiol.139: 88-100 (2005) RD PubMed: 16113211 XX RA Welchen E, Gonzalez DH. RT Overrepresentation of Elements Recognized by TCP-Domain RT Transcription Factors in the Upstream Regions of Nuclear Genes RT Encoding Components of the Mitochondrial Oxidative RT Phosphorylation Machinery. RL Plant Physiol. 141:540-545 (2006) RC in silico RD PubMed: 16760496 XX SQ TGGGCY // ID SITEIIBOSPCNA XX AC S000217 XX DT 10-May-1998 (last modified) kehi XX DE "Site IIb" of rice PCNA (proliferating cell nuclear antigen) DE gene; Found at -178 to -169; Binding site for two nuclear DE proteins, PCF1 and PCF2 (Kosugi and Ohashi, 1997); Suggested to DE be involved in meristematic tissue-specific expression; Resemble DE the conserved motif (T/GGTCCCAT) found in promoter regions of DE auxin-regulated genes; See S000026 (AUXREPSIAA4); XX KW PCNA; Site IIb; meristem; tissue-specific XX OS rice (Oryza sativa) XX RA Kosugi S, Suzuka I, Ohashi Y RT Two of three promoter elements identified in a rice gene for RT proliferating cell nuclear antigen are essential for meristematic RT tissue-specific expression RL Plant J 7:877-886 (1995) RD PubMed: 7599648; XX RA Kosugi S, Ohashi Y RT PCF1 and PCF2 specifically bind to cis elements in the rice RT proliferating cell nuclear antigen gene RL Plant Cell 9:1607-1619 (1997) RD PubMed: 9338963; XX SQ TGGTCCCAC // ID SITEIOSPCNA XX AC S000224 XX DT 10-May-1998 (last modified) kehi XX DE "Site I" of rice (O.s.) PCNA (proliferating cell nuclear antigen) DE gene; Found at -201 to -194; Resemble G-box; May contribute in DE part to transcriptional activation; XX KW PCNA; Site I; G-box; meristem; XX OS rice (Oryza sativa) XX RA Kosugi S, Suzuka I, Ohashi Y RT Two of three promoter elements identified in a rice gene for RT proliferating cell nuclear antigen are essential for meristematic RT tissue-specific expression RL Plant J 7:877-886 (1995) RD PubMed: 7599648; XX SQ CCAGGTGG // ID SORLIP1AT XX AC S000482 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Induced Promoters DE (SORLIPs) in Arabidopsis; Computationally identified phyA-induced DE motifs; SORLIP 1 is most over-represented, and most statistically DE singnificant; See also S000483, S000484, S000485, S000486 (all DE SORLIPs), and also S000487, S000488, S000489, S000490 (all DE SORLREPs); Over-represented in light-induced cotyledon and root DE common genes and root-specific genes (Jiao et al. 2005; see DE S000486); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX RA Jiao Y, Ma L, Strickland E, Deng XW. RT Conservation and Divergence of Light-Regulated Genome Expression RT Patterns during Seedling Development in Rice and Arabidopsis. RL Plant Cell. 17: 3239-3256 (2005) RC in silico; RD PubMed: 16284311 XX SQ GCCAC // ID SORLIP2AT XX AC S000483 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Induced Promoters DE (SORLIPs) in Arabidopsis; Computationally identified phyA-induced DE motifs; See also S000482, S000484, S000485, S000486 (all DE SORLIPs), and also S000487, S000488, S000489, S000490 (all DE SORLREPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ GGGCC // ID SORLIP3AT XX AC S000484 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Induced Promoters DE (SORLIPs) in Arabidopsis; Computationally identified phyA-induced DE motifs; See also S000482, S000483, S000485, S000486 (all DE SORLIPs), and also S000487, S000488, S000489, S000490 (all DE SORLREPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ CTCAAGTGA // ID SORLIP4AT XX AC S000485 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Induced Promoters DE (SORLIPs) in Arabidopsis; Computationally identified phyA-induced DE motifs; See also S000482, S000483, S000484, S000486 (all DE SORLIPs), and also S000487, S000488, S000489, S000490 (all DE SORLREPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ GTATGATGG // ID SORLIP5AT XX AC S000486 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Induced Promoters DE (SORLIPs) in Arabidopsis; Computationally identified phyA-induced DE motifs; See also S000482, S000483, S000484, S000485 (all DE SORLIPs), and also S000487, S000488, S000489, S000490 (all DE SORLREPs); Over-represented in both light-induced DE cotyledon-specific and root-specific genes (Jiao et al. 2005; see DE S000482); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX RA Jiao Y, Ma L, Strickland E, Deng XW. RT Conservation and Divergence of Light-Regulated Genome Expression RT Patterns during Seedling Development in Rice and Arabidopsis. RL Plant Cell. 17: 3239-3256 (2005) RC in silico; RD PubMed: 16284311 XX SQ GAGTGAG // ID SORLREP2AT XX AC S000487 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Repressed Promoters DE (SORLREPs) in Arabidopsis; Computationally identified DE phyA-repressed motifs; See also S000488, S000489, S000490 (all DE SORLREPs); and also S000482, S000483, S000484, S000485, S000486 DE (all SORLIPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ ATAAAACGT // ID SORLREP3AT XX AC S000488 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Repressed Promoters DE (SORLREPs) in Arabidopsis; Computationally identified DE phyA-repressed motifs; See also S000487, S000489, S000490 (all DE SORLREPs); and also S000482, S000483, S000484, S000485, S000486 DE (all SORLIPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ TGTATATAT // ID SORLREP4AT XX AC S000489 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Repressed Promoters DE (SORLREPs) in Arabidopsis; Computationally identified DE phyA-repressed motifs; Common in circadian-regulated promoters; DE See also S000487, S000488, S000490 (all SORLREPs); and also DE S000482, S000483, S000484, S000485, S000486 (all SORLIPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ CTCCTAATT // ID SORLREP5AT XX AC S000490 XX DT 18-November-2005 (last modified) kehi XX DE one of "Sequences Over-Represented in Light-Repressed Promoters DE (SORLREPs) in Arabidopsis; Computationally identified DE phyA-repressed motifs; See also S000487, S000488, S000489 (all DE SORLREPs); and also S000482, S000483, S000484, S000485, S000486 DE (all SORLIPs); XX KW phyA; phytochrome; light; XX OS Arabidopsis thaliana XX RA Hudson ME, Quail PH. RT Identification of promoter motifs involved in the network of RT phytochrome A-regulated gene expression by combined analysis of RT genomic sequence and microarray data. RL Plant Physiol. 133: 1605-1616 (2003) RC in silico; over-represented motif; RD PubMed: 14681527 XX SQ TTGCATGACT // ID SP8BFIBSP8AIB XX AC S000183 XX DT 16-Feb-2001 (last modified) seki XX DE One of SPBF binding site (SP8a); Found at -155 of gSPO-A1 DE (sporamin) gene, and also at -880 of gB-Amy (beta-amylase) gene DE in sweet potato (I.b.); SP8BF recognizes both SP8a and SP8b DE sequences; See also SP8BFIBSP8BIB (S000184); SP8BF activity is DE also found in tobacco; "SP8a" found in the 5' upstream region of DE three differnt genes coding for sporamin and beta-amylase; DE Binding site of SPF1; SPF1 also binds to the SP8b; See S000184; XX KW SP8; SP8a; SP8BF; sporamin; beta-amylase; amylase; tuberous root; KW root; XX OS sweet potato (Ipomoea batatas); XX RA Ishiguro S, Nakamura K RT The nuclear factor SP8BF binds to the 5'-upstream regions of RT three different genes coding for major proteins of sweet potato RT tuberous roots RL Plant Mol Biol 18:97-108 (1992) RD PubMed: 1531033; XX RA Ishiguro S, Nakamura K RT Characterization of a cDNA encoding a novel DNA-binding protein, RT SPF1, that recognizes SP8 sequences in the 5' upstream regions of RT genes coding for sporamin and beta-amylase from sweet potato RL Mol Gen Genet 244: 563-571 (1994) RD PubMed: 7969025; XX SQ ACTGTGTA // ID SP8BFIBSP8BIB XX AC S000184 XX DT 16-Feb-2001 (last modified) seki XX DE One of SPBF binding site (SP8b); Found at -330, -220, and -200 of DE gSPO-B1 (sporamin) gene, and also at -80 of gB-Amy (beta-amylase) DE gene; SP8BF recognizes both SP8a and SP8b sequences; See also DE SP8BFIBSP8AIB (S000183); SP8BF activity is also found in tobacco; DE "SP8b" found in the 5' upstream region of three differnt genes DE coding for sporamin and beta-amylase; Binding site of SPF1; SPF1 DE also binds to the SP8b; See S000184; XX KW SP8; SP8b; SP8BF; sporamin; beta-a,ylase; amylase; tuberous root; KW tuber; root; XX OS sweet potato (Ipomoea batatas); XX RA Ishiguro S, Nakamura K RT The nuclear factor SP8BF binds to the 5'-upstream regions of RT three different genes coding for major proteins of sweet potato RT tuberous roots RL Plant Mol Biol 18:97-108 (1992) RD PubMed: 1531033; XX RA Ishiguro S, Nakamura K RT Characterization of a cDNA encoding a novel DNA-binding protein, RT SPF1, that recognizes SP8 sequences in the 5' upstream regions of RT genes coding for sporamin and beta-amylase from sweet potato RL Mol Gen Genet 244: 563-571 (1994) RD PubMed: 7969025; XX SQ TACTATT // ID SPHCOREZMC1 XX AC S000154 XX DT 16-Feb-2001 (last modified) seki XX DE Core of Sph element; Core motif of Sph element in maize (Z.m.) C1 DE gene to which maize VP1 (viviparous 1) protein binds; DE VP1-responsive element; see RYREPEAT4 (S000010); VP1 gene is DE specifically required for expression of the maturation program in DE seed development; VP1 is a novel transcription factor possibly DE involved in potentiation of a seed-specific hormone response; XX KW Sph motif; C1; VP1; ABA; seed; XX OS maize (Zea mays); XX RA Suzuki M, Kao CY, McCarty DR RT The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA RT binding activity. RL Plant Cell 9:799-807 (1997) RD PubMed: 9165754; XX RA McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK RT The Viviparous-1 developmental gene of maize encodes a novel RT transcriptional activator RL Cell 66: 895-905 (1991) RD PubMed: 1889090; XX SQ TCCATGCAT // ID SPHZMC1 XX AC S000293 XX DT 16-Feb-2001 (last modified) seki XX DE "Sph element" found in the maize (Z.m.) C1 gene promoter; Located DE between -142 and -132; Essential for VP1 activation; See S000154, DE S000294; VP1 gene is specifically required for expression of the DE maturation program in seed development; VP1 is a novel DE transcription factor possibly involved in potentiation of a DE seed-specific hormone response; XX KW C1; anthocyanin pathway; ABA; VP1; light; Sph; seed; XX OS maize (Zea mays) XX RA Kao CY, Cocciolone SM, Vasil IK, McCarty DR RT Localization and interaction of the cis-acting elements for RT abscisic acid, VIVIPAROUS1, and light activation of the C1 gene RT of maize RL Plant Cell 8: 1171-1179 (1996) RD PubMed: 8768375 XX RA McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK RT The Viviparous-1 developmental gene of maize encodes a novel RT transcriptional activator RL Cell 66: 895-905 (1991) RD PubMed: 1889090; XX SQ CGTCCATGCAT // ID SREATMSD XX AC S000470 XX DT 13-August-2005 (last modified) kehi XX DE "sugar-repressive element (SRE)" found in 272 of the 1592 DE down-regulated genes after main stem decapitation in Arabidopsis; DE See also S000471, S000472; XX KW Axillary bud outgrowth; XX OS Arabidopsis thaliana XX RA Tatematsu K, Ward S, Leyser O, Kamiya Y, Nambara E. RT Identification of cis-elements that regulate gene expression RT during initiation of axillary bud outgrowth in Arabidopsis. RL Plant Physiology 138: 757-766 (2005) RD PubMed: 15908603 XX SQ TTATCC // ID SRENTTTO1 XX AC S000271 XX DT 15-Oct-1999 (last modified) kehi XX DE Stress responsive element (SRE) in tobacco (N.t.) retrotransposon DE Tto1; A 13 bp cis-regulatory element in the LTR promoter of the DE tobacco retrotransposon Tto1; Involved in responsiveness to DE tissue culture, wounding, methyl jasmonate and fungal elicitors; DE Contains a conserved motif, Box L; XX KW retrotransposon; LTR; Tto1; wounding; stress; tissue culture; KW methyl jasmonate; fungal elicitor; Box L; XX OS tobacco (Nicotiana tabacum) XX RA Takeda S, Sugimoto K, Otsuki H, Hirochika H RT A 13-bp cis-regulatory element in the LTR promoter of the tobacco RT retrotransposon Tto1 is involved in responsiveness to tissue RT culture, wounding, methyl jasmonate and fungal elicitors RL Plant J 18:383-393 (1999) RD PubMed: 10406122; XX SQ TGGTAGGTGAGAT // ID SURE1STPAT21 XX AC S000186 XX DT 17-May-1998 (last modified) kehi XX DE Sucrose Responsive Element (SURE); A motif conserved among genes DE regulated by sucrose; See also SURE2STPAT21 (S000185); Found DE between -184 and -156 bp in the patatin (a major tuber protein) DE gene promoter of potato (S.t.); XX KW SURE; SURE 1; patatin; sucrose; tuber; root; XX OS potato (Solanum tuberosum); XX RA Grierson C, Du JS, Zabala MT, Beggs K, Smith C, Holdsworth M, RA Bevan M RT Separate cis sequences and trans factors direct metabolic and RT developmental regulation of a potato tuber storage protein gene RL Plant J 5:815-826 (1994) RD PubMed: 8054988; XX SQ AATAGAAAA // ID SURE2STPAT21 XX AC S000185 XX DT 17-May-1998 (last modified) kehi XX DE Sucrose Responsive Element 2 (SURE2); A motif conserved among DE genes regulated by sucrose; See also SURE1ST (S000186); Found DE between -184 and -156 bp in the patatin (a major tuber protein) DE gene promoter of potato (S.t.); XX KW SURE; SURE 2; patatin; sucrose; tuber; root; XX OS potato (Solanum tuberosum); XX RA Grierson C, Du JS, Zabala MT, Beggs K, Smith C, Holdsworth M, RA Bevan M RT Separate cis sequences and trans factors direct metabolic and RT developmental regulation of a potato tuber storage protein gene RL Plant J 5:815-826 (1994) RD PubMed: 8054988; XX SQ AATACTAAT // ID SUREAHVISO1 XX AC S000441 XX DT 28-Jan-2004 (last modified) kehi XX DE "SURE-a"; Sugar-responsive element found in barley (H. vulgare) DE iso1 (encoding isoamylase1) promoter at -597 to -573; Highly DE similar to SURE of potato class-1 putative promoter; SUSIBA2 DE (WRKY transcription factor) binding site; XX KW sugar; SURE; patatin; WRKY; isoamylase; SUSIBA"; XX OS Hordeum vulgare (barley) XX RA Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, Jansson C. RT A novel WRKY transcription factor, SUSIBA2, participates in sugar RT signaling in barley by binding to the sugar-responsive elements RT of the iso1 promoter. RL Plant Cell 15: 2076-2092 (2003) RD PubMed: 12953112; XX SQ AAAACTAAGAAAGACCGATGGAAAA // ID SURECOREATSULTR11 XX AC S000499 XX DT 02-August-2006 (last modified) kehi XX DE Core of sulfur-responsive element (SURE) found in the promoter of DE SULTR1;1 high-affinity sulfate transporter gene in Arabidopsis; DE SURE contains auxin response factor (ARF) binding sequence DE (GAGACA)(see S000270 ARF:TGTCTC; its complementary seq is DE GAGACA), and this core sequence is a part of it; this core seq is DE involved in -S response; Beware of other SURE (sucrose responsive DE element) !!; XX KW sulfate uptake; sulfate transporter; ARF; -S; S; XX OS Arabidopsis thaliana XX RA Maruyama-Nakashita A, Nakamura Y, Watanabe-Takahashi A, Inoue E, RA Yamaya T, Takahashi H. RT Identification of a novel cis-acting element conferring sulfur RT deficiency response in Arabidopsis roots. RL Plant J. 42: 305-314 (2005). RD PubMed: 15842617 XX SQ GAGAC // ID SV40COREENHAN XX AC S000123 XX DT 17-May-1998 (last modified) kehi XX DE "SV40 core enhancer"; Similar sequences found in rbcS genes; DE W=A/T; XX KW enhancer; SV40; core; XX OS virus; plant; pea (Pisum sativum); Arabidopsis thaliana; XX RA Weiher H, Konig M, Gruss P RT Multiple point mutations affecting the simian virus 40 enhancer. RL Science 219:626-631 (1983) RD PubMed: 6297005; XX RA Green PJ, Kay SA, Chua N-H RT Sequence-specific interactions of a pea nuclear factor with RT light-responsive elements upstream of the rbcs3A gene. RL EMBO J 6:2543-2549 (1987) RD PubMed: 3678200; XX RA Donald RGK, Cashmore AR RT Mutation of either G box or I box sequences profoundly affects RT expression from the Arabidopsis rbcs-1A promoter. RL EMBO J 9:1717-1726 (1990) RD PubMed: 2347304; XX SQ GTGGWWHG // ID T/GBOXATPIN2 XX AC S000458 XX DT 29-November-2004 (last modified) kehi XX DE "T/G-box" found in tomato proteinase inhibitor II (pin2) and DE leucine aminopeptidase (LAP) genes; Involved in jasmonate (JA) DE induction of these genes; bHLH-Leu zipper JAMYC2 and JAMYC10 DE proteins specifically recognaize this motif (Boter et al., DE 2004); XX KW T/G-box; JA; pin2; LAP; MYC; wounding; XX OS Lycopersicon esculentum (tomato); Arabidopsis thaliana; XX RA Boter M, Ruiz-Rivero O, Abdeen A, Prat S. RT Conserved MYC transcription factors play a key role in jasmonate RT signaling both in tomato and Arabidopsis. RL Genes Dev 18: 1577-1591 (2004). RD PubMed: 15231736 XX SQ AACGTG // ID TAAAGSTKST1 XX AC S000387 XX DT 20-Feb-2002 (last modified) uchi XX DE TAAAG motif found in promoter of Solanum tuberosum (S.t.) KST1 DE gene; Target site for trans-acting StDof1 protein controlling DE guard cell-specific gene expression; KST1 gene encodes a K+ DE influx channel of guard cells; See S000265; XX KW KST1; Dof; guard cell; XX OS Solanum tuberosum (potato) XX RA Plesch G, Ehrhardt T, Mueller-Roeber B RT Involvement of TAAAG elements suggests a role for Dof RT transcription factors in guard cell-specific gene expression RL Plant J 28: 455-464 (2001) RD PubMed: 11737782; XX SQ TAAAG // ID TACBBFNTEAS4 XX AC S000257 XX DT 14-0ct-1999 (last modified) kehi XX DE TacBBF (TAC box binding factor) binding site in tobacco (N.t.) DE 5-epi-aristolochene synthase (EAS4) gene; Required for DE elicitor-inducibility; EAS is involved in sesquiterpene DE phytoalexin biosynthesis; Found between -245 and -232; Appears to DE function as a silencer or repressor of EAS gene expression; XX KW EAS; elicitor; TAC box; TacBBF; sesquiterpene; phytoalexin; KW silencer; repressor; XX OS tobacco (Nicotiana tabacum) XX RA Newman JD, Yin S, Chappell J RT Characterization of the TAC box, a cis-element within an RT elicitor-inducible sesquiterpene cyclase promoter RL Plant J 16:1-12 (1998) XX SQ ACTCTACAGTACTC // ID TATABOX1 XX AC S000108 XX DT 12-April-2004 (last modified) kehi XX DE "TATA box"; TATA box found in the 5'upstream region of rice DE alpha-amylase; TATA box found in beta-phaseolin promoter (Grace DE et al.); sequence and spacing of TATA box elements are critical DE for accurate initiation (Grace et al.); XX KW amylase; rice; TATA; seed; phaseolin; XX OS rice (Oryza sativa); bean (Phaseolus vulgaris); XX RA Grace ML, Chandrasekharan MB, Hall TC, Crowe AJ. RT Sequence and spacing of TATA box elements are critical for RT accurate initiation from the beta-phaseolin promoter. RL J Biol Chem. 279:8102-8110 (2004). RD PubMed: 14660650 XX SQ CTATAAATAC // ID TATABOX2 XX AC S000109 XX DT 12-April-2004 (last modified) kehi XX DE "TATA box"; TATA box found in the 5'upstream region of pea legA DE gene; sporamin A of sweet potato; TATA box found in DE beta-phaseolin promoter (Grace et al.); sequence and spacing of DE TATA box elements are critical for accurate initiation (Grace et DE al.); XX KW TATA; legA; phaseolin; XX OS pea (Pisum sativum); tobacco (Nicotiana tabacum); bean (Phaseolus OS vulgaris); XX RA Shirsat A, Wilford N, Croy R, Boulter D RT Sequences responsible for the tissue specific promoter activity RT of a pea legumin gene in tobacco. RL Mol Gen Genet 215:326-331 (1989) RD PubMed: 2710102; XX RA Grace ML, Chandrasekharan MB, Hall TC, Crowe AJ. RT Sequence and spacing of TATA box elements are critical for RT accurate initiation from the beta-phaseolin promoter. RL J Biol Chem. 279:8102-8110 (2004). RD PubMed: 14660650 XX SQ TATAAAT // ID TATABOX3 XX AC S000110 XX DT 17-Jun-1997 (last modified) kehi XX DE "TATA box"; TATA box found in the 5'upstream region of sweet DE potato sporamin A gene; XX KW TATA; sporamin; XX OS sweet potato (Ipomoea batatas); XX SQ TATTAAT // ID TATABOX4 XX AC S000111 XX DT 12-April-2004 (last modified) kehi XX DE "TATA box"; TATA box found in the 5'upstream region of sweet DE potato sporamin A gene; TATA box found in beta-phaseolin promoter DE (Grace et al.); sequence and spacing of TATA box elements are DE critical for accurate initiation (Grace et al.); XX KW TATA; sporamin; phaseolin; XX OS sweet potato (Ipomoea batatas); bean (Phaseolus vulgaris) XX RA Grace ML, Chandrasekharan MB, Hall TC, Crowe AJ. RT Sequence and spacing of TATA box elements are critical for RT accurate initiation from the beta-phaseolin promoter. RL J Biol Chem. 279:8102-8110 (2004). RD PubMed: 14660650 XX SQ TATATAA // ID TATABOX5 XX AC S000203 XX DT 17-May-1998 (last modified) kehi XX DE "TATA box"; TATA box found in the 5'upstream region of pea (Pisum DE sativum) glutamine synthetase gene; a functional TATA element by DE in vivo analysis; XX KW TATA; glutamine; synthetase; XX OS pea (Pisum sativum); XX RA Tjaden G, Edwards JW, Coruzzi GM RT cis elements and trans-acting factors affecting regulation of a RT nonphotosynthetic light-regulated gene for chloroplast glutamine RT synthetase RL Plant Physiol 108:1109-1117 (1995) RD PubMed: 7630938; GenBank: U22971; XX SQ TTATTT // ID TATABOXOSPAL XX AC S000400 XX DT 27-Aug-2002 (last modified) uchi XX DE Binding site for OsTBP2, found in the promoter of rice pal gene DE encoding phenylalanine ammonia-lyase; OsTFIIB stimulated the DNA DE binding and bending activities of OsTBP2 and synergistically DE enhanced OsTBP2-mediated transcription from the pal promoter; XX KW TBP; TFIIB; pal; DNA binding and bending; XX OS Oryza sativa (rice) XX RA Zhu Q, Ordiz MI, Dabi T, Beachy RN, Lamb C RT Rice TATA binding protein interacts functionally with RT transcription factor IIB and the RF2a bZIP transcriptional RT activator in an enhanced plant in vitro transcription system RL Plant Cell 14: 795-803 (2002) RD PubMed: 11971135; XX SQ TATTTAA // ID TATAPVTRNALEU XX AC S000340 XX DT 21-May-2002 (last modified) uchi XX DE "TATA-like motif"; A TATA-like sequence found in Phaseolus DE vulgaris tRNALeu gene promoter; Frequently observed upstream of DE plant tRNA genes; Found in maize glycolytic DE glyceraldehyde-3-phospate dehydrogenase 4 (GapC4) gene promoter; DE Binding site of TATA binding protein (TBP); XX KW TATA; tRNA; re-initiation; GapC4; Myb; TATA binding protein; KW TBP; XX OS Phaseolus vulgaris; maize (Zea mays) XX RA Yukawa Y, Sugita M, Choisne N, Small I, Sugiura M RT The TATA motif, the CAA motif and the poly(T) transcription RT termination motif are all important for transcription RT re-initiation on plant tRNA genes RL Plant J 22: 439-447 (2000) RD PubMed: 10849359; XX RA Geffers R, Sell S, Cerff R, Hehl R RT The TATA box and a Myb binding site are essential for anaerobic RT expression of a maize GapC4 minimal promoter in tobacco RL Biochim Biophys Acta 1521: 120-125 (2001) RD PubMed: 11690643; XX SQ TTTATATA // ID TATCCACHVAL21 XX AC S000416 XX DT 10-May-2006 (last modified) kehi XX DE "TATCCAC box" is a part of the conserved cis-acting response DE complex (GARC) that most often contain three sequence motifs, the DE TAACAAA box (see S000181), or GA-responsive element (GARE); the DE pyrimidine box, CCTTTT (see S000259); and the TATCCAC box, which DE are necessary for a full GA response; XX KW gibberellin; GA; GARC; XX OS barley (Hordeum vulgare) XX RA Isabel-LaMoneda I, Diaz I, Martinez M, Mena M, Carbonero P. RT SAD: a new DOF protein from barley that activates transcription RT of a cathepsin B-like thiol protease gene in the aleurone of RT germinating seeds. RL Plant J. 33: 329-340 (2003) RD PubMed: 12535346; XX RA Martinez M, Rubio-Somoza I, Fuentes R, Lara P, Carbonero P, Diaz RA I. RT The barley cystatin gene (Icy) is regulated by DOF transcription RT factors in aleurone cells upon germination. RL J Exp Bot. 56: 547-556 (2005) RD PubMed: 15611149 XX SQ TATCCAC // ID TATCCAOSAMY XX AC S000403 XX DT 15-September-2006 (last modified) kehi XX DE "TATCCA" element found in alpha-amylase promoters of rice (O.s.) DE at positions ca.90 to 150bp upstream of the transcription start DE sites; Binding sites of OsMYBS1, OsMYBS2 and OsMYBS3 which DE mediate sugar and hormone regulation of alpha-amylase gene DE expression; See also S000021 (AMYBOX2); S000256 (TATCCAY motif); XX KW alpha-amylase; MYB proteins; gibberellin; GA; sugar starvation; XX OS Oryza sativa (rice) XX RA Lu CA, Ho THD, Ho SL, Yu SM RT Three Novel MYB Proteins with One DNA Binding Repeat Mediate RT Sugar and Hormone Regulation of alpha-Amylase Gene Expression RL Plant Cell 14: 1963-1980 (2002) RD PubMed: 12172034; XX RA Lu CA, Lim EK, Yu SM. RT Sugar response sequence in the promoter of a rice alpha-amylase RT gene serves as a transcriptional enhancer. RL J Biol Chem. 273:10120-10131(1998). RD PubMed: 9553059 XX RA Chen PW, Chiang CM, Tseng TH, Yu SM RT Interaction between Rice MYBGA and the Gibberellin Response RT Element Controls Tissue-Specific Sugar Sensitivity of RT alpha-Amylase Genes. RL PLANT CELL 18: 2326-2340 (2006). RD PubMed: 16905658 XX SQ TATCCA // ID TATCCAYMOTIFOSRAMY3D XX AC S000256 XX DT 01-August-2006 (last modified) kehi XX DE "TATCCAY motif" found in rice (O.s.) RAmy3D alpha-amylase gene DE promoter; Y=T/C; a GATA motif as its antisense sequence; TATCCAY DE motif and G motif (see S000130) are responsible for sugar DE repression (Toyofuku et al. 1998); XX KW GATA; amylase; sugar; repression; XX OS rice (Oryza sativa) XX RA Toyofuku K, Umemura T, Yamaguchi J RT Promoter elements required for sugar-repression of the RAmy3D RT gene for alpha-amylase in rice RL FEBS Lett 428:275-280 (1998) RD PubMed: 9654148; XX RA Rubio-Somoza I, Martinez M, Abraham Z, Diaz I, Carbonero P. RT Ternary complex formation between HvMYBS3 and other factors RT involved in transcriptional control in barley seeds. RL Plant J. 47: 269-281 (2006) RD PubMed: 16762033 XX SQ TATCCAY // ID TBOXATGAPB XX AC S000383 XX DT 23-Aug-2001 (last modified) uchi XX DE "Tbox" found in the Arabidopsis thaliana (A.T.) GAPB gene DE promoter; Located between -94 and -89 (T1) and also between -84 DE and -79 (T2); Mutations in the "Tbox" resulted in reductions of DE light-activated gene transcription; GAPB encodes the B subunit of DE chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of DE A.T.; XX KW GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated KW transcription; XX OS Arabidopsis thaliana XX RA Chan CS, Guo L, Shih MC RT Promoter analysis of the nuclear gene encoding the chloroplast RT glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis RT thaliana RL Plant Mol Biol 46: 131-141 (2001) RD PubMed: 11442054; XX SQ ACTTTG // ID TCA1MOTIF XX AC S000159 XX DT 17-May-1998 (last modified) kehi XX DE TCA-1 (tobacco nuclear protein 1) binding site; Related to DE salicylic acid-inducible expression of many genes; Found in DE barley beta-1,3-glucanase and over 30 different plant genes which DE are known to be induced by one or more forms of stress; A similar DE sequence (TCATTTCTT) was found in tobacco Tnt1 retrotransposon DE promoter (Mhiri et al., 1997); XX KW SA; salicylic acid; stress; TCA-1; XX OS barley (Hordeum vulgare); tobacco (Nicotiana tabacum); XX RA Goldsbrough AP, Albrecht H, Stratford R RT Salicylic acid-inducible binding of a tobacco nuclear protein to RT a 10 bp sequence which is highly conserved amongst RT stress-inducible genes. RL Plant J 3:563-571 (1993) RD PubMed: 8220463; XX RA Mhiri C, Morel JB, Verbhettes S, Casacuberta JM, Lucas H, RA Graandbastien MA RT The promoter of the tobacco Tnt1 retrotransposon is induced by RT wounding and by abiotic stress RL Plant Mol Biol 33:257-266 (1997) RD PubMed: 9037144; XX SQ TCATCTTCTT // ID TDBA12NTCHN50 XX AC S000266 XX DT 22-June-2006 (last modified) kehi XX DE TDBA12 binding site found in tobacco (N.t.) basic class I DE chitinase gene (CHN50); Elicitor response element; TDBA12 belongs DE to WRKY proteins that appear to be unique to plants; TDBA12 is DE activated by TMV infection in resistant tobacco plant and by DE plant defense signal molecule SA; XX KW TDBA12; chitinase; CHN50; WRKY; HR; TMV; SAR; elicitor; XX OS tobacco (Nicotiana tabacum) XX RA Yang P, Chen C, Wang Z, Fan B, Chen Z RT A pathogen- and salicylic acid-induced WRKY DNA-binding activity RT recognizes the elicitor response element of the tobacco class I RT chitinase gene promoter RL Plant J 18:141-149 (1999) XX RA Eulgem T, Rushton PJ, Robatzek S, Somssich IE RT The WRKY superfamily of plant transcription factors RL Trends Plant Sci 5: 199-206 (2000) RC Review RD PubMed: 10785665; XX SQ TGACTTTCTGAC // ID TE2F2NTPCNA XX AC S000397 XX DT 05-November-2005 (last modified) kehi XX DE "te2f-2" found in the promoter of tobacco PCNA gene; Located DE between -84 and -77; Binding site of OsE2F1 and OsE2F2; Involved DE in transcriptional activation in actively dividing cells and DE tissue; XX KW E2F; PCNA; meristematic tissue; cell cycle; XX OS tobacco (Nicotiana tabacum) XX RA Kosugi S, Ohashi Y RT E2F sites that can interact with E2F proteins cloned from rice RT are required for meristematic tissue-specific expression of rice RT and tobacco proliferating cell nuclear antigen promoters RL Plant J 29: 45-59 (2002) RD PubMed: 12060226; XX SQ ATTCCCGC // ID TEF1BOXATA1 XX AC S000311 XX DT 7-Sep-2000 (last modified) seki XX DE "tef1 box" found in the Arabidopsis (A.t.) EF-1 alpha A1 gene DE promoter; Conserved in the A.t. EF-1 alpha gene promoters; DE Involved in the activation of EF-1 alpha gene; Involved in the DE transcriptional activation of plant genes that are overexpressed DE in cycling cells; Conserved in the promoters of genes for DE products related to the translational apparatus; XX KW EF-1alpha; A1; tef1 box; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Curie C, Liboz T, Bardet C, Gander E, Medale C, Axelos M, Lescure RA B RT Cis and Trans-acting elements involved in the activation of RT Arabidopsis thaliana A1 gene encoding the translation elongation RT factor EF-1alpha RL Nucleic Acids Research 19: 1305-1310 (1991) RD PubMed: 1840652; XX RA Regad F, Herve C, Marinx O, Bergounioux C, Tremousaygue D, Lescue RA B RT The tef1 box, a ubiquitous cis-acting element involved in the RT activation of plant genes that are highly expressed in cycling RT cells RL Mol. Gen. Genet. 248: 703-711 (1995) RD PubMed: 7476873; XX SQ ACAGGGGCATAATGGTAATTTAAA // ID TEFBOXATEEF1AA1 XX AC S000309 XX DT 7-Sep-2000 (last modified) seki XX DE "tef-box" found in the Arabidopsis (A.t.) eEF1AA1 gene promoter; DE An activating sequence associated with telo-box (S000308); DE Required for the gene expression in root primordia; Acts DE co-operatively with telo-box; See S000308; XX KW tef-box; telomere motifl eEF1A; root; primordia; telo-box; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B RT Plant interstitial telomere mitifs participate in the control of RT gene expression in root meristems RL Plant J 20: 553-561 (1999) RD PubMed: 10652127; XX SQ AGGGGCATAATGGTAA // ID TELOBOXATEEF1AA1 XX AC S000308 XX DT 05-November-2005 (last modified) kehi XX DE "telo-box" (telomere motif) found in the Arabidopsis (A.t.) DE eEF1AA1 gene promoter; Conserved in all known plant eEF1A gene DE promoters; Found in the 5' region of numerous genes encoding DE components of the translational apparatus; Required for the DE activation of expression in root primordia; Acts co-operatively DE with tef-box; Binding site of AtPur alpha-1; See S000309, DE S000474; XX KW telo-box; telomere motif; eEF1A; root; primordia; tef-box; Pur KW alpha-1; XX OS Arabidopsis (Arabidopsis thaliana) XX RA Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B RT Plant interstitial telomere mitifs participate in the control of RT gene expression in root meristems RL Plant J 20: 553-561 (1999) RD PubMed: 10652127; XX RA Axelos M, Bardet C, Liboz T, Va Thai AL, Curie C, Lescure B RT The gene family encoding the Arabidopsis thaliana translation RT elongation factor EF-1alpha: Molecular clonig, characterization RT and expression. RL Mol Gen Genet 219: 106-112 (1989) RD PubMed: 2615757 XX RA Welchen E, Gonzalez DH. RT Differential expression of the Arabidopsis cytochrome c genes RT Cytc-1 and Cytc-2. Evidence for the involvement of TCP-domain RT protein-binding elements in anther- and meristem-specific RT expression of the Cytc-1 gene. RL Plant Physiol.139: 88-100 (2005) RD PubMed: 16113211 XX SQ AAACCCTAA // ID TGA1ANTPR1A XX AC S000247 XX DT 16-Feb-2001 (last modified) seki XX DE TGA1a binding site in tobacco (N.t.) PR1a gene; as-1-like DE sequence; Contains two TGACG elements reminiscent of activation DE sequence-1 (as-1); See other as-1-like sequences; TGA1a is DE preferentially expressed in root tip meristems; TGA1a may DE contribute to the expression of GST isoenzymes, especially in DE root tip meristems; XX KW TGA1a; as-1; PR1a; xenobiotic stress; root; tip; meristem; XX OS tobacco (Nicotiana tabacum) XX RA Strompen G, Gruner R, Pfitzner UM RT An as-1-like motif controls the level of expression of the gene RT for the pathogenesis-related protein 1a from tobacco RL Plant Mol Biol 37:871-883 (1998) RD PubMed: 9678582; XX RA Klinedinst S, Pascuzzi P, Redman J, Desai M, Arias J RT A xenobiotic-stress-activated transcription factor and its RT cognate target genes are preferentially expressed in root tip RT meristems RL Plant Mol Biol 42: 679-688 (2000) RD PubMed: 10809441; XX RA Gruner R, Strompen G, Pfitzner AJ, Pfitzner UM. RT Salicylic acid and the hypersensitive response initiate distinct RT signal transduction pathways in tobacco that converge on the RT as-1-like element of the PR-1a promoter. RL Eur J Biochem. 270: 4876-4886 (2003) RD PubMed: 14653814 XX SQ CGTCATCGAGATGACG // ID TGACGTVMAMY XX AC S000377 XX DT 23-Aug-2001 (last modified) uchi XX DE "TGACGT motif" found in the Vigna mungo (V.m.) alpha-Amylase DE (Amy) gene promoter; Located between -128 and -123; Required for DE high level expression of alpha-Amylase in the cotyledons of the DE germinated seeds; See S000234; XX KW alpha-Amylase; cotyledon; seed germination; seed; XX OS Vigna mungo XX RA Yamauchi D RT A TGACGT Motif in the 5'-Upstream Region of alpha-Amylase Gene RT from Vigna mungo is a cis-Element for Expression in Cotyledons of RT Germinated Seeds RL Plant Cell Physiol 42: 635-641 (2001) RD PubMed: 11427683; XX SQ TGACGT // ID TGTCACACMCUCUMISIN XX AC S000422 XX DT 29-Sep-2003 (last modified) kehi XX DE "TGTCACA motif" found in the region (from -254 to -215) of DE cucumisin (a subtilisin-like serine protease) in the fruit of DE melon (Cucumis melo L.); A novel enhancer element necessary for DE fruit-specific expression of the cucumisin gene; XX KW cucumisin; fruit; XX OS Cucumis melo L. (melon) XX RA Yamagata H, Yonesu K, Hirata A, Aizono Y. RT TGTCACA motif is a novel cis-regulatory enhancer element involved RT in fruit-specific expression of the cucumisin gene. RL J Biol Chem. 277:11582-11590 (2002) RD PubMed: 11782472; XX SQ TGTCACA // ID TL1ATSAR XX AC S000473 XX DT 13-August-2005 (last modified) kehi XX DE "TL1", a consensus sequence overrepresented in the promoter DE regions of all 13 NPR1-responsive ER-resident genes surveyed; DE NPR1 is "Nonexpressor of pathogenesis-related genes 1", also DE known as NIM1; XX KW SAR; ER; PR; NIM1; XX OS Arabidopsis thaliana XX RA Wang D, Weaver ND, Kesarwani M, Dong X. RT Induction of protein secretory pathway is required for systemic RT acquired resistance. RL Science 308: 1036-1040 (2005) RC in silico RD PubMed: 15890886 XX SQ CTGAAGAAGAA // ID TOPOISOM XX AC S000112 XX DT 13-Feb-2001 (last modified) kehi XX DE Topoisomerase cleavage site consensus sequence; Motif found in DE SAR (scaffold attachment region; or matrix attachment region, DE MAR); W=T/A, XX KW MAR; SAR; topoisomeras; scaffold; matrix; XX OS fruit fly; Drosophila melanogaster; fly; XX RA Sander M, Hsieh T RT Drosophila topoisomerase II double-strand DNA cleavage: analysis RT of DNA sequence homology at the cleavage site. RL Nucleic Acid Res 13:1057-1072 (1985) RD PubMed: 2987816; GenBank: M30907, M30908; XX RA Gasser SM, Amati BB, Cardenas ME, Hofmann JFX RT Studies on scaffold attachment sites and their relation to genome RT function. RL Intnatl Rev Cyto 119:57-96 (1989) RC Review RD PubMed: 2695485; XX SQ GTNWAYATTNATNNG // ID TRANSINITDICOTS XX AC S000201 XX DT 3-May-1998 (last modified) kehi XX DE Context sequence of translational initiation codon in dicots; DE M=A/C; XX KW Translation; Initiation; XX OS dicots; XX RA Joshi CP, Zhou H, Huang X, Chiang VL RT Context sequences of translation initiation codon in plants RL Plant Mol Biol 35:993-1001 (1997) RD PubMed: 9426620; XX SQ AMNAUGGC // ID TRANSINITMONOCOTS XX AC S000202 XX DT 3-May-1998 (last modified) kehi XX DE Context sequence of translational initiation codon in monocots; DE R=A/G; M=A/C; XX KW Translation; Initiation; XX OS monocots; XX RA Joshi CP, Zhou H, Huang X, Chiang VL RT Context sequences of translation initiation codon in plants RL Plant Mol Biol 35:993-1001 (1997) RD PubMed: 9426620; XX SQ RMNAUGGC // ID TRANSTART XX AC S000113 XX DT 17-May-1998 (last modified) kehi XX DE plant consensus sequence for translation start site; XX KW translation; XX OS rice (Oryza sativa); XX RA Joshi CP RT An inspection of the domain between putative TATA box and RT translation start site in 79 plant genes. RL Nucleic Acids Res 15:6643-6653 (1987) RD PubMed: 3628002; XX RA de Pater S, Hensgens LAM, Schilperoort RA RT Structure and expression of a light-inducible shoot-specific rice RT gene. RL Plant Mol Biol 15:399-406 (1990) RD PubMed: 2103460; GenBank: X51911; XX SQ TAAACAATGGCT // ID UP1ATMSD XX AC S000471 XX DT 13-August-2005 (last modified) kehi XX DE "Up1" motif found in 162 of the 1184 up-regulated genes after DE main stem decapitation in Arabidopsis; W=A/T; See also S000470, DE S000472; XX KW Axillary bud outgrowth; XX OS Arabidopsis thaliana XX RA Tatematsu K, Ward S, Leyser O, Kamiya Y, Nambara E. RT Identification of cis-elements that regulate gene expression RT during initiation of axillary bud outgrowth in Arabidopsis. RL Plant Physiology 138: 757-766 (2005) RD PubMed: 15908603 XX SQ GGCCCAWWW // ID UP2ATMSD XX AC S000472 XX DT 13-August-2005 (last modified) kehi XX DE "Up2" motif found in 193 of the 1184 up-regulated genes after DE main stem decapitation in Arabidopsis; W=A/T; See also S000470, DE S000471; XX KW Axillary bud outgrowth; XX OS Arabidopsis thaliana XX RA Tatematsu K, Ward S, Leyser O, Kamiya Y, Nambara E. RT Identification of cis-elements that regulate gene expression RT during initiation of axillary bud outgrowth in Arabidopsis. RL Plant Physiology 138: 757-766 (2005) RD PubMed: 15908603 XX SQ AAACCCTA // ID UPRE1AT XX AC S000428 XX DT 04-January-2007 (last modified) kehi XX DE "ERSEII-like sequence" found in the plant UPRE (unfolded protein DE response element) in A.t.; See S000429; Either of ERSEII or XBP1 DE binding sites is essential and sufficient for the UPR; See DE S000425, S000426; XX KW UPR; UPRE; unfolded protein response; ERSEII; ERSE; XX OS Arabidopsis thaliana XX RA Oh DH, Kwon CS, Sano H, Chung WI, Koizumi N. RT Conservation between animals and plants of the cis-acting element RT involved in the unfolded protein response. RL Biochem Biophys Res Commun. 301:225-230 (2003) RD PubMed: 12535667; XX RA Martinez IM, Chrispeels MJ. RT Genomic analysis of the unfolded protein response in Arabidopsis RT shows its connection to important cellular processes. RL Plant Cell. 15:561-576 (2003) RD PubMed: 12566592; XX RA Iwata Y, Koizumi N. RT An Arabidopsis transcription factor, AtbZIP60, regulates the RT endoplasmic reticulum stress response in a manner unique to RT plants. RL Proc Natl Acad Sci U S A. 102: 5280-5285. (2005) RD PubMed: 15781873 XX RA Tajima H, Koizumi N. RT Induction of BiP by sugar independent of a cis-element for the RT unfolded protein response in Arabidopsis thaliana. RL Biochem Biophys Res Commun. 346:926-930 (2006) RD PubMed: 16781668 XX SQ ATTGGTCCACG // ID UPRE2AT XX AC S000429 XX DT 04-January-2007 (last modified) kehi XX DE "XBP1 binding site-like sequence" found in the plant UPRE DE (unfolded protein response element) in A.t.; See S000428; Either DE of ERSEII or XBP1 binding sites is essential and sufficient for DE the UPR; See S000425 (CCACGTCA), S000426; XX KW UPR; UPRE; unfolded protein response; ERSEII; ERSE; XX OS Arabidopsis thaliana XX RA Oh DH, Kwon CS, Sano H, Chung WI, Koizumi N. RT Conservation between animals and plants of the cis-acting element RT involved in the unfolded protein response. RL Biochem Biophys Res Commun. 301:225-230 (2003) RD PubMed: 12535667 XX RA Martinez IM, Chrispeels MJ. RT Genomic analysis of the unfolded protein response in Arabidopsis RT shows its connection to important cellular processes. RL Plant Cell. 15:561-576 (2003) RD PubMed: 12566592 XX RA Iwata Y, Koizumi N. RT An Arabidopsis transcription factor, AtbZIP60, regulates the RT endoplasmic reticulum stress response in a manner unique to RT plants. RL Proc Natl Acad Sci U S A. 102: 5280-5285. (2005) RD PubMed: 15781873 XX RA Tajima H, Koizumi N. RT Induction of BiP by sugar independent of a cis-element for the RT unfolded protein response in Arabidopsis thaliana. RL Biochem Biophys Res Commun. 346:926-930 (2006) RD PubMed: 16781668 XX SQ CCACGTCATC // ID UPRMOTIFIAT XX AC S000425 XX DT 29-Sep-2003 (last modified) kehi XX DE "Motif I" in the conserved UPR (unfolded protein response) DE cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, DE SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000429 (CCACGTCATC); DE See also S000426, S000428, S000429; XX KW UPR; unfolded protein response; XX OS Arabidopsis thaliana XX RA Martinez IM, Chrispeels MJ. RT Genomic analysis of the unfolded protein response in Arabidopsis RT shows its connection to important cellular processes. RL Plant Cell. 15:561-576 (2003) RD PubMed: 12566592; XX RA Oh DH, Kwon CS, Sano H, Chung WI, Koizumi N. RT Conservation between animals and plants of the cis-acting element RT involved in the unfolded protein response. RL Biochem Biophys Res Commun. 301:225-230 (2003) RD PubMed: 12535667; XX SQ CCACGTCA // ID UPRMOTIFIIAT XX AC S000426 XX DT 29-Sep-2003 (last modified) kehi XX DE "Motif II" in the conserved UPR (unfolded protein response) DE cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, DE SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000425, S000428, DE S000429; XX KW UPR; unfolded protein response; XX OS Arabidopsis thaliana XX RA Martinez IM, Chrispeels MJ. RT Genomic analysis of the unfolded protein response in Arabidopsis RT shows its connection to important cellular processes. RL Plant Cell. 15:561-576 (2003) RD PubMed: 12566592; XX RA Oh DH, Kwon CS, Sano H, Chung WI, Koizumi N. RT Conservation between animals and plants of the cis-acting element RT involved in the unfolded protein response. RL Biochem Biophys Res Commun. 301:225-230 (2003) RD PubMed: 12535667; XX SQ CCNNNNNNNNNNNNCCACG // ID VOZATVPP XX AC S000456 XX DT 29-November-2004 (last modified) kehi XX DE "VOZ-binding sequence" found in the promoter of A. thaliana DE V-PPase (vacuolar H+-pyrophosphatase) gene; Involved in its DE expression during pollen development; one-zinc finger;(Mitsuda et DE al., 2004); XX KW VOZ; V-PPase; pollen; XX OS Arabidopsis thaliana XX RA Mitsuda N, Hisabori T, Takeyasu K, Sato MH. RT VOZ; isolation and characterization of novel vascular plant RT transcription factors with a one-zinc finger from Arabidopsis RT thaliana. RL Plant Cell Physiol. 45: 845-854 (2004). RD PubMed: 15295067 XX SQ GCGTNNNNNNNACGC // ID VSF1PVGRP18 XX AC S000249 XX DT 19-August-2004 (last modified) kehi XX DE VSF-1 binding site in French bean (P.v.) grp1.8 gene promoter; DE VSF-1 is a tomato bZIP transcription factor; VSF-1 binding site DE is found in 28 bp vs-1 element; This sequence controls vascular DE gene expression in transgenic tobacco; "VS-1" found in bean DE grp1.8 gene promoter; Located between -203 and -176; Partially DE overlaps with NRE; Confers xylem-specific expression; XX KW VSF-1; vascular; grp1.8; VS-1; bZIP; Xylem; XX OS French bean (Phaseolus vulgaris); tomato (Lycopersicon OS esculentum); tobacco (Nicotiana tabacum); XX RA Ringli C, Keller B RT Specific interaction of the tomato bZIP transcription factor RT VSF-1 with a non-palindromic DNA sequence that controls vascular RT gene expression RL Plant Mol Biol 37:977-988 (1998) RD PubMed: 9700070; XX RA Torres-Schumann S, Ringli C, Heierli D, Amrhein N, Keller B. RT In vitro binding of the tomato bZIP transcriptional activator RT VSF-1 to a regulatory element that controls xylem-specific gene RT expression RL Plant J 9:283-296 (1996) RD PubMed: 8919907; XX SQ GCTCCGTTG // ID WARBNEXTA XX AC S000241 XX DT 11-0ct-1999 (last modified) kehi XX DE "WAR (wounding activating region)" in Brassica napus (B.n.) extA DE extensin gene; XX KW wounding; ext; extensin; XX OS Brassica napus XX RA Elliott KA , Shirsat AH RT Promoter regions of the extA extensin gene from Brassica napus RT control activation in response to wounding and tensile stress RL Plant Mol Biol 37:675-687 (1998) RD PubMed: 9687071; XX SQ GTACGTGTTATAAAACGTGT // ID WBBOXPCWRKY1 XX AC S000310 XX DT 22-June-2006 (last modified) kehi XX DE "WB box"; WRKY proteins bind specifically to the DNA sequence DE motif (T)(T)TGAC(C/T), which is known as the W box; Found in DE amylase gene in sweet potato, alpha-Amy2 genes in wheat, barley, DE and wild oat, PR1 gene in parsley, and a transcription factor DE gene in Arabidopsis; The motif was initially registered in DE PLACEdb as TTGACT, and was corrected to TTGACY on 22 June, 2006; DE Y=C/T; XX KW W box; WRKY; XX OS Ipomoea batatas (sweet potato); Triticum aestivum (wheat); OS Hordeum vulgare (barley); Avena fatua (wild oat); Petroselium OS crispum (parsley); Arabidopsis thaliana; XX RA Ishiguro S, Nakamura K. RT Characterization of a cDNA encoding a novel DNA-binding protein, RT SPF1, that recognizes SP8 sequences in the 5' upstream regions of RT genes coding for sporamin and beta-amylase from sweet potato. RL Mol Gen Genet. 244:563-571.(1994) RD PubMed: 7969025 XX RA Rushton PJ, Macdonald H, Huttly AK, Lazarus CM, Hooley R. RT Members of a new family of DNA-binding proteins bind to a RT conserved cis-element in the promoters of alpha-Amy2 genes. RL Plant Mol Biol. 29:691-702 (1995) RD PubMed: 8541496 XX RA Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, RA Somssich IE. RT Interaction of elicitor-induced DNA-binding proteins with RT elicitor response elements in the promoters of parsley PR1 RT genes. RL EMBO J. 15:5690-5700 (1996) RD PubMed: 8896462 XX RA de Pater S, Greco V, Pham K, Memelink J, Kijne J. RT Characterization of a zinc-dependent transcriptional activator RT from Arabidopsis. RL Nucleic Acids Res. 24:4624-4631 (1996) RD PubMed: 8972846 XX RA Eulgem T, Rushton PJ, Robatzek S, Somssich IE RT The WRKY superfamily of plant transcription factors RL Trends Plant Sci 5: 199-206 (2000) RC Review RD PubMed: 10785665; XX SQ TTTGACY // ID WBOXATNPR1 XX AC S000390 XX DT 23-June-2006 (last modified) kehi XX DE "W-box" found in promoter of Arabidopsis thaliana (A.t.) NPR1 DE gene; Located between +70 and +79 in tandem; They were recognized DE specifically by salicylic acid (SA)-induced WRKY DNA binding DE proteins; See S000142 (SQ=TTGACC); See S000310 (SQ=TTTGACY); A DE cluster of WRKY binding sites act as negative regulatory elements DE for the inducible expression of AtWRKY18 (Chena and Chen, 2002); DE See also S000142; XX KW NPR1; WRKY; WRKY18; disease resistance; SA; W box; XX OS Arabidopsis thaliana XX RA Yu D, Chen C, Chen Z RT Evidence for an important role of WRKY DNA binding proteins in RT the regulation of NPR1 gene expression RL Plant Cell 13: 1527-1540 (2001) RD PubMed: 11449049; XX RA Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eulgem T, RA Mauch F, Luan S, Zou G, Whitham SA, Budworth PR, Tao Y, Xie RT Expression profile matrix of Arabidopsis transcription factor RT genes suggests their putative functions in response to RT environmental stresses RL Plant Cell 14: 559-574 (2002) RD PubMed: 11910004; XX RA Eulgem T, Rushton PJ, Robatzek S, Somssich IE. RT The WRKY superfamily of plant transcription factors. RL Trends Plant Sci. 5:199-206. (2000) RC Review. RD PubMed: 10785665 XX RA Chen C, Chen Z. RT Potentiation of developmentally regulated plant defense response RT by AtWRKY18, a pathogen-induced Arabidopsis transcription RT factor. RL Plant Physiol. 129:706-716 (2002) RD PubMed: 12068113 XX RA Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KA, RA Dangl JL, Dietrich RA. RT The transcriptome of Arabidopsis thaliana during systemic RT acquired resistance. RL Nat Genet. 26:403-410 (2000) RD PubMed: 11101835 XX RA Xu X, Chen C, Fan B, Chen Z RT Physical and Functional Interactions between Pathogen-Induced RT Arabidopsis WRKY18, WRKY40, and WRKY60 Transcription Factors. RL Plant Cell 18:1310-1326 (2006) XX SQ TTGAC // ID WBOXGACAD1A XX AC S000448 XX DT 19-August-2004 (last modified) kehi XX DE W-box found in the promoter region of the CAD1-A (cotton (+) DE delta-cadinene synthase-A) gene (located in the region -340 to DE -327) of cotton (G.a); Binding site of GaWRKY1; GaWRKY1 regulates DE sesquiterpene biosynthesis in cotton; See S000390 (TTGAC), DE S000142 (TTGACC); XX KW W-box; TGAC; CAD; WRKY; XX OS Gossypium arboreum (cotton) XX RA Xu YH, Wang JW, Wang S, Wang JY, Chen XY. RT Characterization of GaWRKY1, a cotton transcription factor that RT regulates the sesquiterpene synthase gene (+)-delta-cadinene RT synthase-A. RL Plant Physiol. 135:507-515(2004) RD PubMed: 15133151 XX SQ AGTCAAAATTGACC // ID WBOXHVISO1 XX AC S000442 XX DT 28-Jan-2004 (last modified) kehi XX DE SUSIBA2 bind to W-box element in barley iso1 (encoding DE isoamylase1) promoter; XX KW sugar; SURE; patatin; WRKY; isoamylase; SUSIBA2; XX OS Hordeum vulgare (barley) XX RA Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, Jansson C. RT A novel WRKY transcription factor, SUSIBA2, participates in sugar RT signaling in barley by binding to the sugar-responsive elements RT of the iso1 promoter. RL Plant Cell 15: 2076-2092 (2003) RD PubMed: 12953112; XX SQ TGACT // ID WBOXNTCHN48 XX AC S000508 XX DT 04-January-2007 (last modified) kehi XX DE "W box" identified in the region between -125 and -69 of a DE tobacco class I basic chitinase gene CHN48; NtWRKY1, NtWRKY2 and DE NtWRKY4 bound to W box; NtWRKYs possibly involved in DE elicitor-respsonsive transcription of defense genes in tobacco; DE Y=C/T; see also S000442 (TGACT) and S000447 (TGAC); XX KW W-box; W box; WRKY; elicitor; XX OS Nicotiana tabacum (tobacco) XX RA Yamamoto S, Nakano T, Suzuki K, Shinshi H. RT Elicitor-induced activation of transcription via W box-related RT cis-acting elements from a basic chitinase gene by WRKY RT transcription factors in tobacco. RL Biochim Biophys Acta. 1679:279-287(2004). RD PubMed: 15358520 XX SQ CTGACY // ID WBOXNTERF3 XX AC S000457 XX DT 29-November-2004 (last modified) kehi XX DE "W box" found in the promoter region of a transcriptional DE repressor ERF3 gene in tobacco; May be involved in activation of DE ERF3 gene by wounding;(Nishiuchi et al., 2004) Y=C/T; See DE S000142, S000390, S000442, S000447; XX KW W box; ERF3; wounding; XX OS Nicotiana tabacum (tobacco) XX RA Nishiuchi T, Shinshi H, Suzuki K. RT Rapid and transient activation of transcription of the ERF3 gene RT by wounding in tobacco leaves: Possible involvement of NtWRKYs RT and autorepression. RL J Biol Chem. 279: 55355-55361 (2004) RD PubMed: 15509567 XX SQ TGACY // ID WINPSTPIIIK XX AC S000495 XX DT 10-May-2006 (last modified) kehi XX DE Binding site of wound-inducible nuclear protein from wounded DE tomato leaves; Found in the promoter region of a protease DE inhibitor IIK gene from potato (S.t.); XX KW wound; wounding; XX OS Solanum tuberosum (potato) XX RA Palm CJ, Costa MA, An G, Ryan CA. RT Wound-inducible nuclear protein binds DNA fragments that regulate RT a proteinase inhibitor II gene from potato. RL Proc Natl Acad Sci U S A. 87: 603-607 (1990) RD PubMed: 2405385 XX SQ AAGCGTAAGT // ID WRECSAA01 XX AC S000496 XX DT 10-May-2006 (last modified) kehi XX DE "Wound-responsive element (WRE)" found in the promoter region of DE cucumber (C.s.) ascorbate oxidase gene, CsAAO1; Binding site of DE proteins in tobacco nuclear extracts; W=A/T; S=C/G; XX KW wound; AAO; wounding; XX OS Cucumis sativas (cucumber) XX RA Palm CJ, Costa MA, An G, Ryan CA. RT Wound-inducible nuclear protein binds DNA fragments that regulate RT a proteinase inhibitor II gene from potato. RL Proc Natl Acad Sci U S A. 87: 603-607 (1990) RD PubMed: 2405385 XX SQ AAWGTATCSA // ID WRKY71OS XX AC S000447 XX DT 22-June-2006 (last modified) kehi XX DE "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; DE Binding site of rice WRKY71, a transcriptional repressor of the DE gibberellin signaling pathway; Parsley WRKY proteins bind DE specifically to TGAC-containing W box elements within the DE Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); DE See S000390 (TTGAC), S000442 (TGACT); XX KW WRKY; GA; MYB; W box; TGAC; PR proteins; XX OS Oryza sativa (rice); Petroselinum crispum (parsley); XX RA Zhang ZL, Xie Z, Zou X, Casaretto J, Ho TH, Shen QJ. RT A rice WRKY gene encodes a transcriptional repressor of the RT gibberellin signaling pathway in aleurone cells. RL Plant Physiol. 134:1500-1513(2004) RD PubMed: 15047897 XX RA Xie Z, Zhang ZL, Zou X, Huang J, Ruas P, Thompson D, Shen QJ. RT Annotations and functional analyses of the rice WRKY gene RT superfamily reveal positive and negative regulators of abscisic RT acid signaling in aleurone cells. RL Plant Physiol. 137:176-189 (2005) RD PubMed: 15618416 XX RA Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE. RT Early nuclear events in plant defence signalling: rapid gene RT activation by WRKY transcription factors. RL EMBO J. 18:4689-4699 (1999) RD PubMed: 10469648 XX RA Eulgem T, Rushton PJ, Robatzek S, Somssich IE. RT The WRKY superfamily of plant transcription factors. RL Trends Plant Sci. 5:199-206. (2000) RC Review. RD PubMed: 10785665 XX SQ TGAC // ID WUSATAg XX AC S000433 XX DT 27-Jan-2004 (last modified) kehi XX DE Target sequence of WUS in the intron of AGAMOUS gene in DE Arabidopsis; See Lohmann et al. Cell 105:793-803 (2003); XX OS Oryza sativa (rice) XX RA Kamiya N, Nagasaki H, Morikami A, Sato Y, Matsuoka M. RT Isolation and characterization of arice WUSCHEL-tyope homoebox RT gene that is specifically expressed in the central cells of a RT quiescent center in the root apical meristem. RL Plant J. 35: 429-441 (2003) RD PubMed: 12904206; XX SQ TTAATGG // ID XYLAT XX AC S000510 XX DT 04-January-2007 (last modified) kehi XX DE cis-element identified among the promoters of the "core xylem DE gene set"; XX KW secondary xylem; wood formation; XX OS Arabidopsis thaliana XX RA Ko JH, Beers EP, Han KH. RT Global comparative transcriptome analysis identifies gene network RT regulating secondary xylem development in Arabidopsis thaliana. RL Mol Genet Genomics. 276:517-531 (2006) RC in silico; consensus; RD PubMed: 16969662 XX SQ ACAAAGAA // ID YREGIONNTPRB1B XX AC S000365 XX DT 16-Feb-2001 (last modified) seki XX DE "Y region" found in tobacco (N.t.) PRB-1b gene promoter; Located DE at -179 to -154; Binding site of nuclear protein; Required for DE ethylene induction; See S000364; XX KW PR-1; PRB-1b; ethylene; Y; XX OS Tobacco (Nicotiana tabacum) XX RA Meller Y, Sessa G, Eyal Y, Fluhr R RT DNA-protein interactions on a cis-DNA element essential for RT ethylene regulation RL Plant Mol Biol 23: 453-463 (1993) RD PubMed: 8219081; XX SQ TGTGACATTGAAATTCTTTGACTTTA // ID ZDNAFORMINGATCAB1 XX AC S000321 XX DT 13-August-2005 (last modified) kehi XX DE "Z-DNA-forming sequence" found in the Arabidopsis (A.t.) DE chlorophyll a/b binding protein gene (cab1) promoter; Involved in DE light-dependent developmental expression of the gene; "Z-box"; DE Activation of Z-box containing promoters is regulated by DE downstream regulatory components, COP1 and HY5; phyB and CRY1 DE photoreceptors act redundantly to induce Z-box containing DE promoters in white light; XX KW cab1; light; Z-DNA; leaf; shoot; HY5; COP1; LRE; Z-box; ZBF1; KW Z-box binding factor; XX OS Arabidopsis thaliana XX RA Ha SB, An G RT Identification of upstream regulatory elements involved in the RT developmental expression of the Arabidopsis thaliana cab1 gene. RL Proc Natl Acad Sci USA 85: 8017-8021 (1988) RD PubMed: 3054877 XX RA Yadav V, Kundu S, Chattopadhyay D, Negi P, Wei N, Deng XW, RA Chattopadhyay S RT Light regulated modulation of Z-box containing promoters by RT photoreceptors and downstream regulatory components, COP1 and RT HY5, in Arabidopsis RL Plant J. 31: 741-753 (2002) RD PubMed: 12220265; XX RA Yadav V, Mallappa C, Gangappa SN, Bhatia S, Chattopadhyay S. RT A Basic Helix-Loop-Helix Transcription Factor in Arabidopsis, RT MYC2, Acts as a Repressor of Blue Light-Mediated Photomorphogenic RT Growth. RL Plant Cell 17: 1953-1966 (2005) RD PubMed: 15923349 XX SQ ATACGTGT //